Incidental Mutation 'R9403:Txndc9'
ID 711325
Institutional Source Beutler Lab
Gene Symbol Txndc9
Ensembl Gene ENSMUSG00000058407
Gene Name thioredoxin domain containing 9
Synonyms ATP binding protein associated with cell differentiation, Apacd
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.345) question?
Stock # R9403 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 37985189-37997893 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 37995778 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 15 (E15G)
Ref Sequence ENSEMBL: ENSMUSP00000125491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027252] [ENSMUST00000162031] [ENSMUST00000192237] [ENSMUST00000192960] [ENSMUST00000193832] [ENSMUST00000195032] [ENSMUST00000195247]
AlphaFold Q9CQ79
Predicted Effect probably benign
Transcript: ENSMUST00000027252
SMART Domains Protein: ENSMUSP00000027252
Gene: ENSMUSG00000026083

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
low complexity region 33 51 N/A INTRINSIC
low complexity region 94 106 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 145 161 N/A INTRINSIC
low complexity region 183 193 N/A INTRINSIC
coiled coil region 227 272 N/A INTRINSIC
coiled coil region 301 414 N/A INTRINSIC
low complexity region 480 498 N/A INTRINSIC
coiled coil region 523 554 N/A INTRINSIC
low complexity region 580 594 N/A INTRINSIC
Pfam:GTP_EFTU 625 840 4.7e-35 PFAM
Pfam:MMR_HSR1 629 753 5.1e-6 PFAM
Pfam:GTP_EFTU_D2 866 944 7.1e-11 PFAM
Pfam:IF-2 959 1066 1.4e-20 PFAM
Blast:S1 1116 1172 2e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162031
AA Change: E15G

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000125491
Gene: ENSMUSG00000058407
AA Change: E15G

DomainStartEndE-ValueType
Pfam:Phosducin 15 180 5.1e-8 PFAM
Pfam:Thioredoxin 75 172 9.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192237
AA Change: E15G

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000141640
Gene: ENSMUSG00000058407
AA Change: E15G

DomainStartEndE-ValueType
low complexity region 43 63 N/A INTRINSIC
Pfam:Thioredoxin 75 166 6.1e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000192960
AA Change: E15G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141281
Gene: ENSMUSG00000058407
AA Change: E15G

DomainStartEndE-ValueType
low complexity region 43 63 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000193832
AA Change: E15G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142188
Gene: ENSMUSG00000058407
AA Change: E15G

DomainStartEndE-ValueType
Pfam:Phosducin 15 180 6.1e-5 PFAM
Pfam:Thioredoxin 75 172 6.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195032
AA Change: E15G

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000141595
Gene: ENSMUSG00000058407
AA Change: E15G

DomainStartEndE-ValueType
Pfam:Phosducin 15 180 5.1e-8 PFAM
Pfam:Thioredoxin 75 172 9.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195247
AA Change: E15G

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000141609
Gene: ENSMUSG00000058407
AA Change: E15G

DomainStartEndE-ValueType
Pfam:Phosducin 15 180 5.1e-8 PFAM
Pfam:Thioredoxin 75 172 9.2e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the thioredoxin family. The exact function of this protein is not known but it is associated with cell differentiation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T G 6: 96,165,299 T255P probably benign Het
4930444G20Rik C T 10: 22,067,941 D47N possibly damaging Het
Angpt4 C T 2: 151,938,972 T380M probably damaging Het
Apoa5 G C 9: 46,270,646 R340P probably damaging Het
Cyp3a41a T A 5: 145,702,198 Y320F probably damaging Het
Dmtf1 A G 5: 9,121,927 L503S possibly damaging Het
Dock1 T C 7: 135,168,396 V1795A probably benign Het
Dpys C G 15: 39,828,071 W285S probably damaging Het
Fam187b T C 7: 30,977,090 V8A Het
Fbn2 T C 18: 58,066,107 E1363G probably damaging Het
Glg1 C T 8: 111,187,793 R453Q probably benign Het
Gm5591 T A 7: 38,520,148 M434L probably benign Het
Gm5591 T C 7: 38,522,256 T130A probably damaging Het
Gpld1 G A 13: 24,979,729 V502I probably benign Het
Inhba A G 13: 16,017,381 H29R probably benign Het
Itga4 T A 2: 79,325,660 I990N possibly damaging Het
Kcnma1 T A 14: 23,543,077 I280L probably benign Het
Malrd1 T C 2: 15,614,177 V284A Het
Maml2 C T 9: 13,621,673 Q728* probably null Het
Mkln1 T C 6: 31,432,970 L181P probably damaging Het
Mms22l T C 4: 24,580,204 probably null Het
Muc16 A G 9: 18,537,764 probably null Het
Mylk C A 16: 34,875,642 S249* probably null Het
Naa35 G A 13: 59,601,003 A150T possibly damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nup205 G A 6: 35,199,974 R635H probably benign Het
Olfr263 T C 13: 21,133,695 F307L probably benign Het
Olfr723 T C 14: 49,929,449 T32A probably benign Het
Padi3 T C 4: 140,810,532 I26V probably benign Het
Polq T C 16: 37,061,853 S1460P probably benign Het
Ptgdr A G 14: 44,853,258 S348P Het
Qsox1 A G 1: 155,782,597 S409P probably damaging Het
Rergl T A 6: 139,494,854 Y99F possibly damaging Het
Rptn C A 3: 93,395,042 H22N probably benign Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sh2b1 GGACCAGCTCAG GGACCAGCTCAGTCACGGTGACCAGCTCAG 7: 126,467,573 probably null Het
Sh2b1 ACCAGCTCAGCCACGGGG ACCAGCTCAGCCACGGGGCCCAGCTCAGCCACGGGG 7: 126,467,575 probably benign Het
Slc2a3 A C 6: 122,736,610 I214M probably damaging Het
Slc5a7 A T 17: 54,276,641 N540K probably benign Het
Slco6c1 A T 1: 97,062,523 S664R possibly damaging Het
Tgm4 C A 9: 123,052,772 S344R probably damaging Het
Trim61 T A 8: 65,014,576 Q11L probably damaging Het
Trpm6 C A 19: 18,832,652 D1137E possibly damaging Het
Txndc2 G A 17: 65,637,997 T395I probably damaging Het
Vcpip1 A G 1: 9,745,824 I778T possibly damaging Het
Zfp383 T C 7: 29,915,259 F313S possibly damaging Het
Other mutations in Txndc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1807:Txndc9 UTSW 1 37994015 missense probably damaging 0.99
R3918:Txndc9 UTSW 1 37994050 nonsense probably null
R4489:Txndc9 UTSW 1 37995790 nonsense probably null
R4742:Txndc9 UTSW 1 37987684 missense possibly damaging 0.90
R5020:Txndc9 UTSW 1 37995712 missense probably benign 0.44
R5341:Txndc9 UTSW 1 37987623 utr 3 prime probably benign
R6441:Txndc9 UTSW 1 37990218 missense possibly damaging 0.47
R6917:Txndc9 UTSW 1 37995806 missense probably benign 0.23
R7145:Txndc9 UTSW 1 37990296 missense probably damaging 0.98
R7686:Txndc9 UTSW 1 37987768 missense probably benign 0.04
R9359:Txndc9 UTSW 1 37995778 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CTCCAGTGATTCAGTGAGCAGG -3'
(R):5'- CTGGACTTGTAACGTTTATGTCAGG -3'

Sequencing Primer
(F):5'- ATTCAGTGAGCAGGCGGGC -3'
(R):5'- ACATGCTGAGTTCTAAGGCC -3'
Posted On 2022-05-16