Incidental Mutation 'R3927:Zzz3'
ID 308319
Institutional Source Beutler Lab
Gene Symbol Zzz3
Ensembl Gene ENSMUSG00000039068
Gene Name zinc finger, ZZ domain containing 3
Synonyms 3110065C23Rik, 6430567E01Rik
MMRRC Submission 040822-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R3927 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 152395473-152462826 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 152455862 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 298 (Y298H)
Ref Sequence ENSEMBL: ENSMUSP00000101709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089982] [ENSMUST00000106100] [ENSMUST00000106101] [ENSMUST00000106103] [ENSMUST00000200570]
AlphaFold Q6KAQ7
Predicted Effect probably damaging
Transcript: ENSMUST00000089982
AA Change: Y798H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087428
Gene: ENSMUSG00000039068
AA Change: Y798H

DomainStartEndE-ValueType
SANT 657 711 1.42e-9 SMART
low complexity region 776 787 N/A INTRINSIC
low complexity region 799 814 N/A INTRINSIC
ZnF_ZZ 823 871 6.46e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106100
AA Change: Y799H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101706
Gene: ENSMUSG00000039068
AA Change: Y799H

DomainStartEndE-ValueType
SANT 658 712 1.42e-9 SMART
low complexity region 777 788 N/A INTRINSIC
low complexity region 800 815 N/A INTRINSIC
ZnF_ZZ 824 872 6.46e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106101
AA Change: Y799H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101707
Gene: ENSMUSG00000039068
AA Change: Y799H

DomainStartEndE-ValueType
SANT 658 712 1.42e-9 SMART
low complexity region 777 788 N/A INTRINSIC
low complexity region 800 815 N/A INTRINSIC
ZnF_ZZ 824 872 6.46e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106103
AA Change: Y298H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101709
Gene: ENSMUSG00000039068
AA Change: Y298H

DomainStartEndE-ValueType
SANT 157 211 1.42e-9 SMART
low complexity region 276 287 N/A INTRINSIC
low complexity region 299 314 N/A INTRINSIC
ZnF_ZZ 323 371 6.46e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135044
Predicted Effect probably damaging
Transcript: ENSMUST00000200570
AA Change: Y302H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143693
Gene: ENSMUSG00000039068
AA Change: Y302H

DomainStartEndE-ValueType
SANT 161 215 1.42e-9 SMART
low complexity region 280 291 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
ZnF_ZZ 327 375 6.46e-3 SMART
Meta Mutation Damage Score 0.2487 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 95% (40/42)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 A G 2: 103,708,218 probably null Het
Alpk1 T C 3: 127,677,716 H1039R probably damaging Het
Avpr1a A G 10: 122,449,711 S303G probably benign Het
Axdnd1 A G 1: 156,419,270 L79S probably damaging Het
Baz1a A G 12: 54,921,143 I667T possibly damaging Het
Bend5 A G 4: 111,448,605 Y282C possibly damaging Het
Clstn3 T C 6: 124,451,368 D438G probably damaging Het
Cog3 A G 14: 75,743,558 probably benign Het
Cyp2j6 T C 4: 96,553,288 N55S probably benign Het
Eif4b G A 15: 102,084,310 G101R probably damaging Het
Epha2 T C 4: 141,306,550 L40P probably damaging Het
Fig4 A G 10: 41,263,139 V356A probably benign Het
Hal T C 10: 93,514,026 probably benign Het
Helz A G 11: 107,685,292 Y1770C unknown Het
Meis3 A G 7: 16,177,494 T39A probably benign Het
Nod1 G T 6: 54,944,917 R139S probably benign Het
Olfr430 A T 1: 174,069,312 N5Y probably damaging Het
Pacsin3 C T 2: 91,262,941 probably null Het
Plekhh1 T A 12: 79,053,648 I130N probably damaging Het
Plxna2 G A 1: 194,746,157 E512K probably benign Het
Ppp1r9a A G 6: 5,057,531 I215M probably damaging Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Sap130 A T 18: 31,674,382 H414L possibly damaging Het
Slc33a1 A G 3: 63,963,724 I156T probably benign Het
Slc37a2 G A 9: 37,235,507 T338M probably damaging Het
Spinkl T A 18: 44,169,163 probably null Het
Tmc5 T A 7: 118,652,655 L657* probably null Het
Tmem217 A G 17: 29,526,703 S18P probably damaging Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Tubb4a A G 17: 57,080,967 V353A probably benign Het
Ube3b T C 5: 114,415,680 F974L probably benign Het
Ubqln5 A G 7: 104,128,471 L382P probably damaging Het
Ufsp2 T A 8: 45,983,686 probably null Het
Unkl C T 17: 25,229,329 T66I probably damaging Het
Xrn2 T A 2: 147,038,189 N477K probably benign Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zzef1 T C 11: 72,858,382 S899P probably damaging Het
Other mutations in Zzz3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00691:Zzz3 APN 3 152428514 missense probably benign 0.16
IGL00707:Zzz3 APN 3 152449043 nonsense probably null
IGL00983:Zzz3 APN 3 152455810 splice site probably benign
IGL01586:Zzz3 APN 3 152455839 missense possibly damaging 0.80
IGL01973:Zzz3 APN 3 152428370 missense probably benign 0.00
IGL02002:Zzz3 APN 3 152451369 missense probably damaging 0.98
IGL02009:Zzz3 APN 3 152428115 missense possibly damaging 0.80
IGL02260:Zzz3 APN 3 152452083 missense probably benign 0.04
IGL02336:Zzz3 APN 3 152428059 missense possibly damaging 0.74
IGL02454:Zzz3 APN 3 152428574 missense probably benign 0.03
IGL02519:Zzz3 APN 3 152427390 missense probably damaging 1.00
R0067:Zzz3 UTSW 3 152428403 missense possibly damaging 0.88
R0067:Zzz3 UTSW 3 152428403 missense possibly damaging 0.88
R0314:Zzz3 UTSW 3 152427448 missense probably benign 0.00
R0536:Zzz3 UTSW 3 152448828 missense probably damaging 1.00
R1706:Zzz3 UTSW 3 152449098 missense probably damaging 1.00
R2869:Zzz3 UTSW 3 152446844 synonymous silent
R2870:Zzz3 UTSW 3 152446844 synonymous silent
R2871:Zzz3 UTSW 3 152446844 synonymous silent
R2872:Zzz3 UTSW 3 152446844 synonymous silent
R4195:Zzz3 UTSW 3 152428465 missense probably benign 0.02
R4768:Zzz3 UTSW 3 152448783 missense probably damaging 1.00
R5248:Zzz3 UTSW 3 152427545 missense probably damaging 0.99
R5566:Zzz3 UTSW 3 152455824 missense probably damaging 1.00
R5752:Zzz3 UTSW 3 152452122 missense possibly damaging 0.48
R5782:Zzz3 UTSW 3 152428100 missense possibly damaging 0.69
R5884:Zzz3 UTSW 3 152450658 missense probably damaging 1.00
R6008:Zzz3 UTSW 3 152428151 missense probably benign 0.01
R6155:Zzz3 UTSW 3 152427682 missense possibly damaging 0.57
R6557:Zzz3 UTSW 3 152428460 missense probably damaging 1.00
R6865:Zzz3 UTSW 3 152428053 missense probably benign 0.01
R7344:Zzz3 UTSW 3 152452099 missense probably damaging 0.98
R7588:Zzz3 UTSW 3 152422768 missense possibly damaging 0.85
R7636:Zzz3 UTSW 3 152427652 missense probably benign
R7732:Zzz3 UTSW 3 152448842 missense probably damaging 1.00
R8157:Zzz3 UTSW 3 152449648 missense probably null 0.71
R8490:Zzz3 UTSW 3 152428653 nonsense probably null
R8926:Zzz3 UTSW 3 152427892 missense possibly damaging 0.76
R9143:Zzz3 UTSW 3 152458271 missense probably benign 0.04
R9243:Zzz3 UTSW 3 152428283 missense probably damaging 1.00
X0018:Zzz3 UTSW 3 152428733 missense possibly damaging 0.88
Z1176:Zzz3 UTSW 3 152449097 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGGCACTGTAGCTCATCTGAG -3'
(R):5'- CTCGGTGCTAGGAGATTTCAG -3'

Sequencing Primer
(F):5'- TGCCTGTAAACTCAGTGCAG -3'
(R):5'- AGGAGATTTCAGAGTTGGATAATCC -3'
Posted On 2015-04-17