Mutagenetix > Incidental Mutation

Incidental Mutation 'R3927:Ube3b'

308325

Institutional Source

Beutler Lab

Gene Symbol

Ube3b

Ensembl Gene

ENSMUSG00000029577

Gene Name

ubiquitin protein ligase E3B

Synonyms

MMRRC Submission

040822-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3927 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

114380607-114421169 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 114415680 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 974 (F974L)

Ref Sequence

ENSEMBL: ENSMUSP00000073652 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000130169]

AlphaFold

Q9ES34

Predicted Effect

probably benign
Transcript: ENSMUST00000074002
AA Change: F974L

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577
AA Change: F974L

Domain	Start	End	E-Value	Type
IQ	28	50	1.17e-2	SMART
low complexity region	310	327	N/A	INTRINSIC
low complexity region	412	428	N/A	INTRINSIC
low complexity region	470	488	N/A	INTRINSIC
HECTc	697	1070	2.15e-110	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000130169

SMART Domains

Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577

Domain	Start	End	E-Value	Type
IQ	28	50	1.17e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150630

Predicted Effect

probably benign
Transcript: ENSMUST00000196651

SMART Domains

Protein: ENSMUSP00000143455
Gene: ENSMUSG00000029577

Domain	Start	End	E-Value	Type
HECTc	122	495	1.1e-112	SMART

Meta Mutation Damage Score

0.6212

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.5%

Validation Efficiency

95% (40/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abtb2	A	G	2: 103,708,218		probably null	Het
Alpk1	T	C	3: 127,677,716	H1039R	probably damaging	Het
Avpr1a	A	G	10: 122,449,711	S303G	probably benign	Het
Axdnd1	A	G	1: 156,419,270	L79S	probably damaging	Het
Baz1a	A	G	12: 54,921,143	I667T	possibly damaging	Het
Bend5	A	G	4: 111,448,605	Y282C	possibly damaging	Het
Clstn3	T	C	6: 124,451,368	D438G	probably damaging	Het
Cog3	A	G	14: 75,743,558		probably benign	Het
Cyp2j6	T	C	4: 96,553,288	N55S	probably benign	Het
Eif4b	G	A	15: 102,084,310	G101R	probably damaging	Het
Epha2	T	C	4: 141,306,550	L40P	probably damaging	Het
Fig4	A	G	10: 41,263,139	V356A	probably benign	Het
Hal	T	C	10: 93,514,026		probably benign	Het
Helz	A	G	11: 107,685,292	Y1770C	unknown	Het
Meis3	A	G	7: 16,177,494	T39A	probably benign	Het
Nod1	G	T	6: 54,944,917	R139S	probably benign	Het
Olfr430	A	T	1: 174,069,312	N5Y	probably damaging	Het
Pacsin3	C	T	2: 91,262,941		probably null	Het
Plekhh1	T	A	12: 79,053,648	I130N	probably damaging	Het
Plxna2	G	A	1: 194,746,157	E512K	probably benign	Het
Ppp1r9a	A	G	6: 5,057,531	I215M	probably damaging	Het
Ryr3	C	G	2: 112,675,873	R3443P	probably damaging	Het
Sap130	A	T	18: 31,674,382	H414L	possibly damaging	Het
Slc33a1	A	G	3: 63,963,724	I156T	probably benign	Het
Slc37a2	G	A	9: 37,235,507	T338M	probably damaging	Het
Spinkl	T	A	18: 44,169,163		probably null	Het
Tmc5	T	A	7: 118,652,655	L657*	probably null	Het
Tmem217	A	G	17: 29,526,703	S18P	probably damaging	Het
Trim43a	GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT	GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT	9: 88,582,989		probably benign	Het
Tubb4a	A	G	17: 57,080,967	V353A	probably benign	Het
Ubqln5	A	G	7: 104,128,471	L382P	probably damaging	Het
Ufsp2	T	A	8: 45,983,686		probably null	Het
Unkl	C	T	17: 25,229,329	T66I	probably damaging	Het
Xrn2	T	A	2: 147,038,189	N477K	probably benign	Het
Zfhx4	C	T	3: 5,403,358	P2859S	probably benign	Het
Zzef1	T	C	11: 72,858,382	S899P	probably damaging	Het
Zzz3	T	C	3: 152,455,862	Y298H	probably damaging	Het

Other mutations in Ube3b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00754:Ube3b	APN	5	114415287	missense	possibly damaging	0.93
IGL01154:Ube3b	APN	5	114406252	missense	probably null	0.86
IGL02632:Ube3b	APN	5	114398841	missense	probably benign
IGL02850:Ube3b	APN	5	114406249	missense	probably damaging	1.00
IGL02878:Ube3b	APN	5	114404717	splice site	probably null
IGL02881:Ube3b	APN	5	114412884	missense	possibly damaging	0.78
R0003:Ube3b	UTSW	5	114398851	missense	probably benign	0.17
R0071:Ube3b	UTSW	5	114419497	missense	probably damaging	1.00
R0071:Ube3b	UTSW	5	114419497	missense	probably damaging	1.00
R0076:Ube3b	UTSW	5	114408217	critical splice donor site	probably null
R0076:Ube3b	UTSW	5	114408217	critical splice donor site	probably null
R0111:Ube3b	UTSW	5	114390376	splice site	probably benign
R0309:Ube3b	UTSW	5	114419469	splice site	probably benign
R0718:Ube3b	UTSW	5	114402555	nonsense	probably null
R1344:Ube3b	UTSW	5	114418575	missense	probably damaging	1.00
R1350:Ube3b	UTSW	5	114406137	splice site	probably null
R1418:Ube3b	UTSW	5	114418575	missense	probably damaging	1.00
R1732:Ube3b	UTSW	5	114387445	missense	probably benign	0.01
R1764:Ube3b	UTSW	5	114404617	missense	possibly damaging	0.89
R1975:Ube3b	UTSW	5	114399865	missense	possibly damaging	0.80
R2014:Ube3b	UTSW	5	114411149	missense	probably damaging	1.00
R2015:Ube3b	UTSW	5	114411149	missense	probably damaging	1.00
R2041:Ube3b	UTSW	5	114387233	missense	probably damaging	0.99
R2074:Ube3b	UTSW	5	114415255	missense	probably benign	0.14
R2202:Ube3b	UTSW	5	114389074	missense	probably damaging	1.00
R2205:Ube3b	UTSW	5	114389074	missense	probably damaging	1.00
R3826:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3829:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3830:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3974:Ube3b	UTSW	5	114412430	missense	probably benign	0.05
R4049:Ube3b	UTSW	5	114412870	missense	probably benign	0.09
R4096:Ube3b	UTSW	5	114393086	missense	possibly damaging	0.65
R4261:Ube3b	UTSW	5	114398428	missense	possibly damaging	0.80
R4415:Ube3b	UTSW	5	114412444	missense	probably damaging	1.00
R4688:Ube3b	UTSW	5	114393078	missense	probably benign	0.03
R4779:Ube3b	UTSW	5	114404717	splice site	probably null
R4824:Ube3b	UTSW	5	114415726	splice site	probably null
R4868:Ube3b	UTSW	5	114398427	missense	probably benign	0.00
R4953:Ube3b	UTSW	5	114401410	missense	probably benign	0.01
R5013:Ube3b	UTSW	5	114407641	missense	probably damaging	1.00
R5057:Ube3b	UTSW	5	114406257	missense	probably benign	0.01
R5117:Ube3b	UTSW	5	114419631	missense	probably damaging	0.96
R5131:Ube3b	UTSW	5	114407546	missense	probably damaging	1.00
R5498:Ube3b	UTSW	5	114418574	missense	probably damaging	1.00
R5564:Ube3b	UTSW	5	114389075	missense	probably damaging	1.00
R5572:Ube3b	UTSW	5	114406179	missense	probably damaging	0.99
R5580:Ube3b	UTSW	5	114415323	missense	probably benign
R5596:Ube3b	UTSW	5	114406160	splice site	probably null
R5843:Ube3b	UTSW	5	114412299	missense	probably damaging	1.00
R5910:Ube3b	UTSW	5	114415309	missense	possibly damaging	0.63
R6591:Ube3b	UTSW	5	114408124	missense	probably benign	0.00
R6691:Ube3b	UTSW	5	114408124	missense	probably benign	0.00
R7148:Ube3b	UTSW	5	114406252	missense	probably damaging	0.97
R7334:Ube3b	UTSW	5	114415681	missense	possibly damaging	0.64
R7438:Ube3b	UTSW	5	114415284	missense	possibly damaging	0.79
R7438:Ube3b	UTSW	5	114418626	missense	probably damaging	1.00
R7640:Ube3b	UTSW	5	114415323	missense	probably benign
R7825:Ube3b	UTSW	5	114401312	missense	probably damaging	1.00
R7958:Ube3b	UTSW	5	114401423	missense	probably benign	0.05
R8025:Ube3b	UTSW	5	114408209	missense	probably damaging	0.99
R8058:Ube3b	UTSW	5	114406785	missense	possibly damaging	0.58
R8087:Ube3b	UTSW	5	114412489	critical splice donor site	probably null
R8182:Ube3b	UTSW	5	114392138	missense	possibly damaging	0.77
R8322:Ube3b	UTSW	5	114402686	missense	probably benign	0.04
R8465:Ube3b	UTSW	5	114390390	missense	probably damaging	1.00
R8682:Ube3b	UTSW	5	114412290	missense	probably damaging	1.00
R8708:Ube3b	UTSW	5	114393090	missense	probably benign	0.34
R8758:Ube3b	UTSW	5	114415200	critical splice acceptor site	probably benign
R8784:Ube3b	UTSW	5	114388739	missense	probably damaging	1.00
R9058:Ube3b	UTSW	5	114415239	missense	probably benign	0.05
R9072:Ube3b	UTSW	5	114404546	missense	probably damaging	0.98
R9116:Ube3b	UTSW	5	114404776	intron	probably benign
R9537:Ube3b	UTSW	5	114387184	missense	probably damaging	1.00
R9596:Ube3b	UTSW	5	114389110	missense	probably damaging	1.00
R9632:Ube3b	UTSW	5	114415309	missense	probably benign	0.00
R9710:Ube3b	UTSW	5	114415309	missense	probably benign	0.00
X0017:Ube3b	UTSW	5	114415585	missense	possibly damaging	0.77

Predicted Primers

PCR Primer
(F):5'- TAGTTTCCGGGAGATGAGGC -3'
(R):5'- CTAAGCACAGTGATGCACAGG -3'

Sequencing Primer
(F):5'- CCATGGTATGGGTGCACCTC -3'
(R):5'- CTCCACAGCAAGGAGCCG -3'

Posted On

2015-04-17