Mutagenetix > Incidental Mutation

Incidental Mutation 'R3931:Dhx29'

308479

Institutional Source

Beutler Lab

Gene Symbol

Dhx29

Ensembl Gene

ENSMUSG00000042426

Gene Name

DExH-box helicase 29

Synonyms

E130202M19Rik, DEAH (Asp-Glu-Ala-His) box polypeptide 29

MMRRC Submission

040918-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3931 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

113063988-113105966 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 113095499 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 942 (V942E)

Ref Sequence

ENSEMBL: ENSMUSP00000035244 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038574]

AlphaFold

Q6PGC1

Predicted Effect

probably damaging
Transcript: ENSMUST00000038574
AA Change: V942E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000035244
Gene: ENSMUSG00000042426
AA Change: V942E

Domain	Start	End	E-Value	Type
low complexity region	10	36	N/A	INTRINSIC
low complexity region	41	54	N/A	INTRINSIC
low complexity region	209	225	N/A	INTRINSIC
low complexity region	240	255	N/A	INTRINSIC
coiled coil region	279	308	N/A	INTRINSIC
low complexity region	343	358	N/A	INTRINSIC
Blast:DEXDc	411	450	2e-14	BLAST
DEXDc	569	763	1.09e-27	SMART
low complexity region	846	856	N/A	INTRINSIC
HELICc	880	985	6.1e-17	SMART
HA2	1047	1138	8.9e-26	SMART
Pfam:OB_NTP_bind	1178	1298	3.8e-19	PFAM

Meta Mutation Damage Score

0.4255

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.3%
20x: 94.8%

Validation Efficiency

100% (30/30)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAH (Asp-Glu-Ala-His) subfamily of proteins, part of the DEAD (Asp-Glu-Ala-Asp) box family of RNA helicases. The encoded protein functions in translation initiation, and is specifically required for ribosomal scanning across stable mRNA secondary structures during initiation codon selection. This protein may also play a role in sensing virally derived cytosolic nucleic acids. Knockdown of this gene results in reduced protein translation and impaired proliferation of cancer cells. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A730049H05Rik	A	C	6: 92,811,420 (GRCm39)		probably benign	Het
Cbarp	A	G	10: 79,971,348 (GRCm39)	L159P	probably damaging	Het
Ccnd2	A	G	6: 127,107,422 (GRCm39)	I249T	probably damaging	Het
Cerk	G	T	15: 86,039,311 (GRCm39)	C193*	probably null	Het
Chrna2	A	G	14: 66,387,216 (GRCm39)	E454G	probably benign	Het
Clnk	T	C	5: 38,925,412 (GRCm39)	T130A	probably benign	Het
Dcbld2	T	C	16: 58,285,701 (GRCm39)	L620P	probably damaging	Het
Dnah17	C	T	11: 117,971,675 (GRCm39)		probably benign	Het
Dnai1	G	A	4: 41,604,229 (GRCm39)	C212Y	probably damaging	Het
Dpep1	A	G	8: 123,925,518 (GRCm39)	D57G	possibly damaging	Het
Gfm2	G	A	13: 97,311,532 (GRCm39)	V701I	probably benign	Het
Grm1	C	T	10: 10,595,622 (GRCm39)	A669T	probably benign	Het
Hsd3b3	C	T	3: 98,649,492 (GRCm39)	G277D	probably damaging	Het
Hsf5	A	G	11: 87,522,508 (GRCm39)	Y367C	probably damaging	Het
Kirrel1	C	T	3: 86,996,458 (GRCm39)	M380I	probably null	Het
Lipo4	C	T	19: 33,480,619 (GRCm39)	V250I	probably benign	Het
Lrrc14	T	C	15: 76,597,765 (GRCm39)	V165A	probably benign	Het
Map3k9	A	G	12: 81,819,691 (GRCm39)	F188L	probably damaging	Het
Mpo	A	G	11: 87,691,866 (GRCm39)	Y433C	probably damaging	Het
Nsd2	A	G	5: 34,003,461 (GRCm39)	K185E	probably benign	Het
Or6n2	T	A	1: 173,897,147 (GRCm39)	F94L	probably damaging	Het
Oxct1	T	A	15: 4,066,601 (GRCm39)	N72K	possibly damaging	Het
Ptpn12	A	G	5: 21,206,321 (GRCm39)	I324T	probably benign	Het
Sez6	T	C	11: 77,867,708 (GRCm39)	I875T	probably damaging	Het
Tpr	T	A	1: 150,311,655 (GRCm39)	V1811E	probably damaging	Het
Trpc4	A	G	3: 54,225,516 (GRCm39)	D871G	probably damaging	Het
Upf2	A	G	2: 6,051,821 (GRCm39)	E1161G	unknown	Het
Zp2	T	C	7: 119,731,580 (GRCm39)		probably benign	Het

Other mutations in Dhx29

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Dhx29	APN	13	113,101,137 (GRCm39)	missense	probably benign	0.15
IGL00434:Dhx29	APN	13	113,091,759 (GRCm39)	missense	probably benign	0.00
IGL00659:Dhx29	APN	13	113,103,169 (GRCm39)	splice site	probably benign
IGL01618:Dhx29	APN	13	113,101,756 (GRCm39)	missense	probably damaging	1.00
IGL01777:Dhx29	APN	13	113,067,406 (GRCm39)	missense	probably benign	0.42
IGL02010:Dhx29	APN	13	113,103,168 (GRCm39)	critical splice donor site	probably null
IGL02125:Dhx29	APN	13	113,091,834 (GRCm39)	splice site	probably benign
IGL02324:Dhx29	APN	13	113,064,342 (GRCm39)	missense	probably damaging	1.00
IGL02801:Dhx29	APN	13	113,101,180 (GRCm39)	missense	probably damaging	1.00
R0001:Dhx29	UTSW	13	113,101,090 (GRCm39)	missense	probably damaging	0.99
R0362:Dhx29	UTSW	13	113,099,393 (GRCm39)	missense	probably benign
R0468:Dhx29	UTSW	13	113,099,811 (GRCm39)	missense	probably benign
R0569:Dhx29	UTSW	13	113,084,748 (GRCm39)	missense	probably benign	0.01
R0714:Dhx29	UTSW	13	113,064,499 (GRCm39)	missense	possibly damaging	0.55
R1460:Dhx29	UTSW	13	113,101,744 (GRCm39)	splice site	probably benign
R1579:Dhx29	UTSW	13	113,072,132 (GRCm39)	critical splice donor site	probably null
R1657:Dhx29	UTSW	13	113,089,377 (GRCm39)	missense	probably damaging	1.00
R1735:Dhx29	UTSW	13	113,081,620 (GRCm39)	missense	probably benign	0.00
R1768:Dhx29	UTSW	13	113,084,774 (GRCm39)	missense	probably damaging	1.00
R1851:Dhx29	UTSW	13	113,084,815 (GRCm39)	missense	probably damaging	1.00
R1937:Dhx29	UTSW	13	113,101,864 (GRCm39)	missense	probably benign	0.06
R2180:Dhx29	UTSW	13	113,099,406 (GRCm39)	critical splice donor site	probably null
R2219:Dhx29	UTSW	13	113,089,338 (GRCm39)	missense	probably damaging	1.00
R2442:Dhx29	UTSW	13	113,083,508 (GRCm39)	missense	possibly damaging	0.94
R2679:Dhx29	UTSW	13	113,083,910 (GRCm39)	critical splice donor site	probably null
R2908:Dhx29	UTSW	13	113,064,385 (GRCm39)	missense	possibly damaging	0.78
R2912:Dhx29	UTSW	13	113,072,109 (GRCm39)	missense	probably damaging	1.00
R3414:Dhx29	UTSW	13	113,083,807 (GRCm39)	missense	probably damaging	0.99
R3957:Dhx29	UTSW	13	113,067,455 (GRCm39)	missense	probably benign
R4065:Dhx29	UTSW	13	113,101,276 (GRCm39)	critical splice donor site	probably null
R4207:Dhx29	UTSW	13	113,064,483 (GRCm39)	missense	probably benign	0.01
R4422:Dhx29	UTSW	13	113,083,781 (GRCm39)	missense	probably damaging	1.00
R4717:Dhx29	UTSW	13	113,083,469 (GRCm39)	missense	unknown
R4718:Dhx29	UTSW	13	113,083,469 (GRCm39)	missense	unknown
R5125:Dhx29	UTSW	13	113,069,134 (GRCm39)	missense	possibly damaging	0.81
R5178:Dhx29	UTSW	13	113,069,134 (GRCm39)	missense	possibly damaging	0.81
R5263:Dhx29	UTSW	13	113,084,755 (GRCm39)	missense	probably damaging	1.00
R5458:Dhx29	UTSW	13	113,103,155 (GRCm39)	missense	probably benign	0.00
R5469:Dhx29	UTSW	13	113,081,073 (GRCm39)	missense	possibly damaging	0.94
R5541:Dhx29	UTSW	13	113,076,908 (GRCm39)	missense	possibly damaging	0.47
R5573:Dhx29	UTSW	13	113,069,749 (GRCm39)	missense	probably benign	0.07
R5664:Dhx29	UTSW	13	113,083,413 (GRCm39)	missense	probably damaging	1.00
R5682:Dhx29	UTSW	13	113,067,383 (GRCm39)	missense	probably damaging	1.00
R5769:Dhx29	UTSW	13	113,090,251 (GRCm39)	missense	probably damaging	0.99
R5917:Dhx29	UTSW	13	113,099,377 (GRCm39)	missense	probably damaging	1.00
R5928:Dhx29	UTSW	13	113,101,002 (GRCm39)	missense	probably benign	0.00
R6115:Dhx29	UTSW	13	113,089,335 (GRCm39)	critical splice acceptor site	probably null
R6144:Dhx29	UTSW	13	113,101,105 (GRCm39)	missense	probably damaging	1.00
R6195:Dhx29	UTSW	13	113,101,071 (GRCm39)	missense	probably benign	0.08
R6233:Dhx29	UTSW	13	113,101,071 (GRCm39)	missense	probably benign	0.08
R6430:Dhx29	UTSW	13	113,081,153 (GRCm39)	missense	possibly damaging	0.77
R6480:Dhx29	UTSW	13	113,090,322 (GRCm39)	nonsense	probably null
R6527:Dhx29	UTSW	13	113,069,076 (GRCm39)	missense	probably damaging	1.00
R6856:Dhx29	UTSW	13	113,089,395 (GRCm39)	missense	probably benign	0.43
R7391:Dhx29	UTSW	13	113,099,393 (GRCm39)	missense	probably benign
R7555:Dhx29	UTSW	13	113,064,176 (GRCm39)	start gained	probably benign
R7602:Dhx29	UTSW	13	113,081,093 (GRCm39)	missense	possibly damaging	0.95
R8744:Dhx29	UTSW	13	113,089,418 (GRCm39)	missense	possibly damaging	0.54
R9281:Dhx29	UTSW	13	113,078,240 (GRCm39)	missense	possibly damaging	0.82
R9450:Dhx29	UTSW	13	113,083,862 (GRCm39)	missense	possibly damaging	0.78
R9496:Dhx29	UTSW	13	113,089,460 (GRCm39)	missense	probably damaging	1.00
R9716:Dhx29	UTSW	13	113,081,612 (GRCm39)	missense	possibly damaging	0.83
Z1177:Dhx29	UTSW	13	113,092,051 (GRCm39)	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- GGAAGGAAGTGGCTTTCTTTAGTCC -3'
(R):5'- CACTGTTGGTAAAATCCAAGGTATG -3'

Sequencing Primer
(F):5'- CCCCCACTCTACTGCTGTC -3'
(R):5'- GGTATGAAATTCTGAAATGTACTCCC -3'

Posted On

2015-04-17