Incidental Mutation 'R7602:Dhx29'
ID 588083
Institutional Source Beutler Lab
Gene Symbol Dhx29
Ensembl Gene ENSMUSG00000042426
Gene Name DEAH (Asp-Glu-Ala-His) box polypeptide 29
Synonyms E130202M19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7602 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 112927454-112969432 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 112944559 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 376 (S376T)
Ref Sequence ENSEMBL: ENSMUSP00000035244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038574] [ENSMUST00000224176]
AlphaFold Q6PGC1
Predicted Effect possibly damaging
Transcript: ENSMUST00000038574
AA Change: S376T

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000035244
Gene: ENSMUSG00000042426
AA Change: S376T

DomainStartEndE-ValueType
low complexity region 10 36 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 209 225 N/A INTRINSIC
low complexity region 240 255 N/A INTRINSIC
coiled coil region 279 308 N/A INTRINSIC
low complexity region 343 358 N/A INTRINSIC
Blast:DEXDc 411 450 2e-14 BLAST
DEXDc 569 763 1.09e-27 SMART
low complexity region 846 856 N/A INTRINSIC
HELICc 880 985 6.1e-17 SMART
HA2 1047 1138 8.9e-26 SMART
Pfam:OB_NTP_bind 1178 1298 3.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224176
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAH (Asp-Glu-Ala-His) subfamily of proteins, part of the DEAD (Asp-Glu-Ala-Asp) box family of RNA helicases. The encoded protein functions in translation initiation, and is specifically required for ribosomal scanning across stable mRNA secondary structures during initiation codon selection. This protein may also play a role in sensing virally derived cytosolic nucleic acids. Knockdown of this gene results in reduced protein translation and impaired proliferation of cancer cells. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik T C 11: 103,200,178 M114V probably benign Het
1700025G04Rik A T 1: 151,980,515 Y34N probably damaging Het
5730559C18Rik G T 1: 136,225,397 C252* probably null Het
A2m T C 6: 121,642,007 V237A probably damaging Het
A2m A T 6: 121,670,936 D1129V possibly damaging Het
Abca7 A G 10: 79,998,012 probably null Het
Ap3m2 T C 8: 22,792,754 N256S probably benign Het
Atr C T 9: 95,907,383 H1531Y possibly damaging Het
Carmil3 C T 14: 55,501,508 A873V probably null Het
Casp8 A C 1: 58,833,739 K258T probably benign Het
Cast A G 13: 74,736,965 S222P probably benign Het
Cpsf7 C T 19: 10,535,373 P274S probably damaging Het
Ddx24 A T 12: 103,416,260 L688* probably null Het
Ddx59 A G 1: 136,433,821 I475V probably benign Het
Dhx57 G T 17: 80,274,861 N438K probably benign Het
Dlk1 T A 12: 109,455,625 probably null Het
Epha6 T C 16: 59,775,568 D920G probably damaging Het
Exo5 A T 4: 120,921,621 V349E probably benign Het
Fam234b T C 6: 135,225,243 V321A possibly damaging Het
Gbp3 A G 3: 142,569,061 E383G probably benign Het
Gga2 T C 7: 121,997,330 N408S probably benign Het
Gm5346 C T 8: 43,626,666 G174R probably damaging Het
Gm8298 T C 3: 59,877,276 I390T probably benign Het
Gse1 T C 8: 120,569,304 V532A unknown Het
Hnrnpul2 T C 19: 8,831,309 Y712H probably damaging Het
Hpca T C 4: 129,120,226 probably benign Het
Ifitm3 A G 7: 141,010,459 F63L probably damaging Het
Kank1 A T 19: 25,422,161 T940S probably benign Het
Klhl9 C A 4: 88,722,409 probably benign Het
Krt36 T C 11: 100,102,960 M351V probably benign Het
Mthfd2 T C 6: 83,311,848 N125D probably benign Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Ncoa2 A G 1: 13,177,126 S358P possibly damaging Het
Nmnat1 T C 4: 149,473,351 H78R probably benign Het
Olfr1026 A T 2: 85,923,802 Y178F probably damaging Het
Olfr173 T C 16: 58,796,980 I289V possibly damaging Het
Olfr823 A G 10: 130,112,310 M160T probably benign Het
Olfr982 T G 9: 40,075,159 L288R probably damaging Het
Pabpc4 A T 4: 123,292,892 D302V possibly damaging Het
Pgap1 A T 1: 54,543,186 S167R probably damaging Het
Phf12 T C 11: 78,023,283 L517P probably benign Het
Rcan2 A G 17: 44,017,798 D86G probably benign Het
Ryk T C 9: 102,898,516 Y442H probably damaging Het
Scfd2 G T 5: 74,462,610 Q421K probably benign Het
Sirpa G T 2: 129,609,152 V111F probably damaging Het
Skint4 A T 4: 112,118,271 T143S possibly damaging Het
Slc12a8 C A 16: 33,625,124 H463N probably benign Het
Sp110 G A 1: 85,579,092 R417C probably benign Het
Sptlc2 A G 12: 87,341,689 Y340H probably damaging Het
Ssc5d T A 7: 4,942,746 W926R possibly damaging Het
Tgfa A G 6: 86,269,962 E82G probably damaging Het
Thrsp A G 7: 97,417,307 I66T probably damaging Het
Ttn T C 2: 76,851,644 E1003G unknown Het
Tube1 A T 10: 39,142,266 H113L probably benign Het
Uri1 A G 7: 37,981,628 V117A probably benign Het
Ush2a G A 1: 188,648,409 C2305Y probably damaging Het
Zbtb7a T G 10: 81,144,176 V68G probably damaging Het
Zfr T A 15: 12,159,677 D686E possibly damaging Het
Zscan4f G A 7: 11,401,381 S238N possibly damaging Het
Other mutations in Dhx29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Dhx29 APN 13 112964603 missense probably benign 0.15
IGL00434:Dhx29 APN 13 112955225 missense probably benign 0.00
IGL00659:Dhx29 APN 13 112966635 splice site probably benign
IGL01618:Dhx29 APN 13 112965222 missense probably damaging 1.00
IGL01777:Dhx29 APN 13 112930872 missense probably benign 0.42
IGL02010:Dhx29 APN 13 112966634 critical splice donor site probably null
IGL02125:Dhx29 APN 13 112955300 splice site probably benign
IGL02324:Dhx29 APN 13 112927808 missense probably damaging 1.00
IGL02801:Dhx29 APN 13 112964646 missense probably damaging 1.00
R0001:Dhx29 UTSW 13 112964556 missense probably damaging 0.99
R0362:Dhx29 UTSW 13 112962859 missense probably benign
R0468:Dhx29 UTSW 13 112963277 missense probably benign
R0569:Dhx29 UTSW 13 112948214 missense probably benign 0.01
R0714:Dhx29 UTSW 13 112927965 missense possibly damaging 0.55
R1460:Dhx29 UTSW 13 112965210 splice site probably benign
R1579:Dhx29 UTSW 13 112935598 critical splice donor site probably null
R1657:Dhx29 UTSW 13 112952843 missense probably damaging 1.00
R1735:Dhx29 UTSW 13 112945086 missense probably benign 0.00
R1768:Dhx29 UTSW 13 112948240 missense probably damaging 1.00
R1851:Dhx29 UTSW 13 112948281 missense probably damaging 1.00
R1937:Dhx29 UTSW 13 112965330 missense probably benign 0.06
R2180:Dhx29 UTSW 13 112962872 critical splice donor site probably null
R2219:Dhx29 UTSW 13 112952804 missense probably damaging 1.00
R2442:Dhx29 UTSW 13 112946974 missense possibly damaging 0.94
R2679:Dhx29 UTSW 13 112947376 critical splice donor site probably null
R2908:Dhx29 UTSW 13 112927851 missense possibly damaging 0.78
R2912:Dhx29 UTSW 13 112935575 missense probably damaging 1.00
R3414:Dhx29 UTSW 13 112947273 missense probably damaging 0.99
R3931:Dhx29 UTSW 13 112958965 missense probably damaging 1.00
R3957:Dhx29 UTSW 13 112930921 missense probably benign
R4065:Dhx29 UTSW 13 112964742 critical splice donor site probably null
R4207:Dhx29 UTSW 13 112927949 missense probably benign 0.01
R4422:Dhx29 UTSW 13 112947247 missense probably damaging 1.00
R4717:Dhx29 UTSW 13 112946935 missense unknown
R4718:Dhx29 UTSW 13 112946935 missense unknown
R5125:Dhx29 UTSW 13 112932600 missense possibly damaging 0.81
R5178:Dhx29 UTSW 13 112932600 missense possibly damaging 0.81
R5263:Dhx29 UTSW 13 112948221 missense probably damaging 1.00
R5458:Dhx29 UTSW 13 112966621 missense probably benign 0.00
R5469:Dhx29 UTSW 13 112944539 missense possibly damaging 0.94
R5541:Dhx29 UTSW 13 112940374 missense possibly damaging 0.47
R5573:Dhx29 UTSW 13 112933215 missense probably benign 0.07
R5664:Dhx29 UTSW 13 112946879 missense probably damaging 1.00
R5682:Dhx29 UTSW 13 112930849 missense probably damaging 1.00
R5769:Dhx29 UTSW 13 112953717 missense probably damaging 0.99
R5917:Dhx29 UTSW 13 112962843 missense probably damaging 1.00
R5928:Dhx29 UTSW 13 112964468 missense probably benign 0.00
R6115:Dhx29 UTSW 13 112952801 critical splice acceptor site probably null
R6144:Dhx29 UTSW 13 112964571 missense probably damaging 1.00
R6195:Dhx29 UTSW 13 112964537 missense probably benign 0.08
R6233:Dhx29 UTSW 13 112964537 missense probably benign 0.08
R6430:Dhx29 UTSW 13 112944619 missense possibly damaging 0.77
R6480:Dhx29 UTSW 13 112953788 nonsense probably null
R6527:Dhx29 UTSW 13 112932542 missense probably damaging 1.00
R6856:Dhx29 UTSW 13 112952861 missense probably benign 0.43
R7391:Dhx29 UTSW 13 112962859 missense probably benign
R7555:Dhx29 UTSW 13 112927642 start gained probably benign
R8744:Dhx29 UTSW 13 112952884 missense possibly damaging 0.54
R9281:Dhx29 UTSW 13 112941706 missense possibly damaging 0.82
R9450:Dhx29 UTSW 13 112947328 missense possibly damaging 0.78
R9496:Dhx29 UTSW 13 112952926 missense probably damaging 1.00
R9716:Dhx29 UTSW 13 112945078 missense possibly damaging 0.83
Z1177:Dhx29 UTSW 13 112955517 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GGTCCCTTCAGAAATGCTGTTC -3'
(R):5'- AGTTTCTCGAATGCCTACTTGATC -3'

Sequencing Primer
(F):5'- CTGTTCTTAAAAGGGCGAGCAC -3'
(R):5'- CTACAGGTCAGGCTAGCTTTGAAC -3'
Posted On 2019-10-24