Mutagenetix > Incidental Mutations

Incidental Mutation 'R4016:Unc93b1'

311965

Institutional Source

Beutler Lab

Gene Symbol

Unc93b1

Ensembl Gene

ENSMUSG00000036908

Gene Name

unc-93 homolog B1 (C. elegans)

Synonyms

unc-93 homolog B, unc-93 related protein

MMRRC Submission

040847-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4016 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

3935186-3949340 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 3943572 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 338 (I338T)

Ref Sequence

ENSEMBL: ENSMUSP00000128751 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000162708] [ENSMUST00000165711]

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161415

Predicted Effect

probably damaging
Transcript: ENSMUST00000162708
AA Change: I338T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124272
Gene: ENSMUSG00000036908
AA Change: I338T

Domain	Start	End	E-Value	Type
low complexity region	66	78	N/A	INTRINSIC
transmembrane domain	81	103	N/A	INTRINSIC
Pfam:UNC-93	135	214	1.6e-8	PFAM
transmembrane domain	238	260	N/A	INTRINSIC
transmembrane domain	306	328	N/A	INTRINSIC
transmembrane domain	364	386	N/A	INTRINSIC
transmembrane domain	396	418	N/A	INTRINSIC
transmembrane domain	423	445	N/A	INTRINSIC
transmembrane domain	460	482	N/A	INTRINSIC
transmembrane domain	494	513	N/A	INTRINSIC
transmembrane domain	518	535	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000165711
AA Change: I338T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128751
Gene: ENSMUSG00000036908
AA Change: I338T

Domain	Start	End	E-Value	Type
low complexity region	66	78	N/A	INTRINSIC
transmembrane domain	81	103	N/A	INTRINSIC
Pfam:UNC-93	135	214	5.1e-9	PFAM
transmembrane domain	243	265	N/A	INTRINSIC
transmembrane domain	305	327	N/A	INTRINSIC
transmembrane domain	367	389	N/A	INTRINSIC

Meta Mutation Damage Score

0.2564

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.4%

Validation Efficiency

100% (49/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in innate and adaptive immune response by regulating toll-like receptor signaling. The encoded protein traffics nucleotide sensing toll-like receptors to the endolysosome from the endoplasmic reticulum. Deficiency of the encoded protein has been associated with herpes simplex encephalitis. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice with a transmembrane domain point mutation have no overt phenotype but fail to mount a normal cytokine response and exhibit increased susceptibility to mouse cytomegalovirus, Lysteria monocytogenes and Staphlococcus aureus. Antigen presentation by MHC class I and II is impaired. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh8a1	G	A	10: 21,395,571	V399I	probably benign	Het
Apold1	A	G	6: 134,983,906	I108V	probably benign	Het
Arpc5	G	A	1: 152,768,856		probably benign	Het
Capn11	T	A	17: 45,653,756	D45V	probably damaging	Het
Dctpp1	G	A	7: 127,257,113	R146C	probably damaging	Het
Dlat	C	T	9: 50,649,631		probably null	Het
Dock10	T	A	1: 80,606,569	D140V	probably damaging	Het
Dtx3	A	G	10: 127,191,171	V378A	probably benign	Het
Ezh2	A	G	6: 47,544,582	I414T	probably benign	Het
Gm1979	C	T	5: 26,004,606	W41*	probably null	Het
Igf2bp2	T	C	16: 22,063,676	N425S	probably damaging	Het
Kdm5a	T	A	6: 120,394,106	Y504N	probably damaging	Het
Map3k21	T	A	8: 125,911,185	I170N	probably damaging	Het
Mrgpra6	C	A	7: 47,188,715	C245F	possibly damaging	Het
Nipal2	T	G	15: 34,600,061	K203N	possibly damaging	Het
Nlrp1b	A	G	11: 71,173,085	F621S	probably damaging	Het
Nos3	G	A	5: 24,371,716	V448M	probably damaging	Het
Ntrk3	G	T	7: 78,462,947		probably benign	Het
Olfr1474	A	T	19: 13,471,197	T76S	possibly damaging	Het
P2rx1	T	C	11: 73,009,973	C190R	probably damaging	Het
Pdzrn4	T	A	15: 92,399,749	D198E	probably benign	Het
Ptar1	A	G	19: 23,687,460	M1V	probably null	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Purg	T	A	8: 33,386,991	L219*	probably null	Het
Rbp3	G	T	14: 33,955,390	V432L	possibly damaging	Het
Scnn1b	G	T	7: 121,914,332		probably null	Het
Sgms1	A	G	19: 32,142,792	V238A	possibly damaging	Het
Slc16a14	G	T	1: 84,912,507	S359*	probably null	Het
Smarca2	G	A	19: 26,683,927		probably null	Het
Spatc1l	A	G	10: 76,562,489	S42G	probably benign	Het
Stra6	T	A	9: 58,135,190	V34E	probably damaging	Het
Tex14	A	G	11: 87,538,623		probably null	Het
Tox4	T	C	14: 52,285,904		probably null	Het
Tyr	A	G	7: 87,437,940	S455P	probably benign	Het
Uggt2	T	C	14: 119,026,433	N1062D	possibly damaging	Het
Umod	A	C	7: 119,476,690	N284K	possibly damaging	Het
Vmn2r99	C	T	17: 19,378,570	T172I	possibly damaging	Het
Whrn	G	A	4: 63,415,639	Q415*	probably null	Het

Other mutations in Unc93b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01088:Unc93b1	APN	19	3935356	splice site	probably null
IGL02631:Unc93b1	APN	19	3942026	splice site	probably benign
IGL02942:Unc93b1	APN	19	3948686	missense	probably damaging	1.00
IGL03149:Unc93b1	APN	19	3944041	missense	probably benign
3d	UTSW	19	3944168	missense	possibly damaging	0.96
novelty	UTSW	19	3943632	missense	probably damaging	1.00
speciality	UTSW	19	3941910	missense	possibly damaging	0.51
R0680:Unc93b1	UTSW	19	3947093	missense	probably benign
R1237:Unc93b1	UTSW	19	3935228	missense	possibly damaging	0.72
R1557:Unc93b1	UTSW	19	3942403	missense	probably benign	0.13
R1992:Unc93b1	UTSW	19	3944062	missense	probably benign	0.00
R2435:Unc93b1	UTSW	19	3936373	missense	possibly damaging	0.89
R4080:Unc93b1	UTSW	19	3941959	missense	probably damaging	0.99
R4479:Unc93b1	UTSW	19	3935236	missense	probably benign	0.16
R4829:Unc93b1	UTSW	19	3944293	missense	probably damaging	1.00
R4947:Unc93b1	UTSW	19	3935871	missense	probably benign	0.05
R4964:Unc93b1	UTSW	19	3942023	splice site	probably null
R4966:Unc93b1	UTSW	19	3942023	splice site	probably null
R5056:Unc93b1	UTSW	19	3942762	missense	possibly damaging	0.45
R5166:Unc93b1	UTSW	19	3944027	missense	probably damaging	1.00
R5441:Unc93b1	UTSW	19	3943703	missense	probably benign	0.01
R5892:Unc93b1	UTSW	19	3943632	missense	probably damaging	1.00
R6382:Unc93b1	UTSW	19	3935297	missense	probably benign	0.19
R6556:Unc93b1	UTSW	19	3944105	missense	probably benign
R6962:Unc93b1	UTSW	19	3936303	missense	possibly damaging	0.57
R7143:Unc93b1	UTSW	19	3935204	missense	unknown
R7748:Unc93b1	UTSW	19	3935250	missense	unknown
R7866:Unc93b1	UTSW	19	3935243	missense	not run
R8198:Unc93b1	UTSW	19	3941910	missense	possibly damaging	0.51
R9212:Unc93b1	UTSW	19	3943557	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGACTGCAGCTCACTTTTC -3'
(R):5'- GCATCTGAAATTCAAGTTTAGCCAG -3'

Sequencing Primer
(F):5'- CTGGAACTCTCTATGTAGACCAGG -3'
(R):5'- GACATCTTGTCTGTTCTTACCAGGG -3'

Posted On

2015-04-29