Mutagenetix > Incidental Mutation

Incidental Mutation 'R4016:Ptch1'

311956

Institutional Source

Beutler Lab

Gene Symbol

Ptch1

Ensembl Gene

ENSMUSG00000021466

Gene Name

patched 1

Synonyms

A230106A15Rik, Patched 1, Ptc1, Ptc

MMRRC Submission

040847-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4016 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

63508328-63573598 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 63524959 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Alanine at position 944 (E944A)

Ref Sequence

ENSEMBL: ENSMUSP00000021921 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021921] [ENSMUST00000192155] [ENSMUST00000194663] [ENSMUST00000195258]

AlphaFold

Q61115

Predicted Effect

probably benign
Transcript: ENSMUST00000021921
AA Change: E944A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000021921
Gene: ENSMUSG00000021466
AA Change: E944A

Domain	Start	End	E-Value	Type
low complexity region	4	30	N/A	INTRINSIC
Pfam:Patched	351	871	7.6e-47	PFAM
Pfam:Sterol-sensing	448	602	1.5e-45	PFAM
Pfam:Patched	952	1166	9.8e-33	PFAM
low complexity region	1180	1189	N/A	INTRINSIC
low complexity region	1204	1213	N/A	INTRINSIC
low complexity region	1281	1296	N/A	INTRINSIC
low complexity region	1355	1367	N/A	INTRINSIC
low complexity region	1369	1384	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000192155
AA Change: E807A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000141489
Gene: ENSMUSG00000021466
AA Change: E807A

Domain	Start	End	E-Value	Type
Pfam:Patched	214	733	3.1e-44	PFAM
Pfam:Sterol-sensing	311	465	2.8e-46	PFAM
Pfam:Patched	814	1029	3.1e-30	PFAM
low complexity region	1043	1052	N/A	INTRINSIC
low complexity region	1067	1076	N/A	INTRINSIC
low complexity region	1144	1159	N/A	INTRINSIC
low complexity region	1218	1230	N/A	INTRINSIC
low complexity region	1232	1247	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000194663

SMART Domains

Protein: ENSMUSP00000141766
Gene: ENSMUSG00000021466

Domain	Start	End	E-Value	Type
Pfam:Patched	298	569	4.7e-34	PFAM
Pfam:Sterol-sensing	396	550	7.9e-47	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000195258

SMART Domains

Protein: ENSMUSP00000141309
Gene: ENSMUSG00000021466

Domain	Start	End	E-Value	Type
Pfam:Patched	212	426	7.8e-28	PFAM
Pfam:Sterol-sensing	311	426	8e-33	PFAM

Meta Mutation Damage Score

0.1368

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.4%

Validation Efficiency

100% (49/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the patched gene family. The encoded protein is the receptor for sonic hedgehog, a secreted molecule implicated in the formation of embryonic structures and in tumorigenesis, as well as the desert hedgehog and indian hedgehog proteins. This gene functions as a tumor suppressor. Mutations of this gene have been associated with basal cell nevus syndrome, esophageal squamous cell carcinoma, trichoepitheliomas, transitional cell carcinomas of the bladder, as well as holoprosencephaly. Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences and biological validity cannot be determined currently. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die by day 10 with neural tube defects. Heterozygotes are large with excess cerebellar granule cell proliferation and sometimes, hindlimb defects and medulloblastomas. Hypomorphic and spontaneous mutants have reproductive defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh8a1	G	A	10: 21,395,571	V399I	probably benign	Het
Apold1	A	G	6: 134,983,906	I108V	probably benign	Het
Arpc5	G	A	1: 152,768,856		probably benign	Het
Capn11	T	A	17: 45,653,756	D45V	probably damaging	Het
Dctpp1	G	A	7: 127,257,113	R146C	probably damaging	Het
Dlat	C	T	9: 50,649,631		probably null	Het
Dock10	T	A	1: 80,606,569	D140V	probably damaging	Het
Dtx3	A	G	10: 127,191,171	V378A	probably benign	Het
Ezh2	A	G	6: 47,544,582	I414T	probably benign	Het
Gm1979	C	T	5: 26,004,606	W41*	probably null	Het
Igf2bp2	T	C	16: 22,063,676	N425S	probably damaging	Het
Kdm5a	T	A	6: 120,394,106	Y504N	probably damaging	Het
Map3k21	T	A	8: 125,911,185	I170N	probably damaging	Het
Mrgpra6	C	A	7: 47,188,715	C245F	possibly damaging	Het
Nipal2	T	G	15: 34,600,061	K203N	possibly damaging	Het
Nlrp1b	A	G	11: 71,173,085	F621S	probably damaging	Het
Nos3	G	A	5: 24,371,716	V448M	probably damaging	Het
Ntrk3	G	T	7: 78,462,947		probably benign	Het
Olfr1474	A	T	19: 13,471,197	T76S	possibly damaging	Het
P2rx1	T	C	11: 73,009,973	C190R	probably damaging	Het
Pdzrn4	T	A	15: 92,399,749	D198E	probably benign	Het
Ptar1	A	G	19: 23,687,460	M1V	probably null	Het
Purg	T	A	8: 33,386,991	L219*	probably null	Het
Rbp3	G	T	14: 33,955,390	V432L	possibly damaging	Het
Scnn1b	G	T	7: 121,914,332		probably null	Het
Sgms1	A	G	19: 32,142,792	V238A	possibly damaging	Het
Slc16a14	G	T	1: 84,912,507	S359*	probably null	Het
Smarca2	G	A	19: 26,683,927		probably null	Het
Spatc1l	A	G	10: 76,562,489	S42G	probably benign	Het
Stra6	T	A	9: 58,135,190	V34E	probably damaging	Het
Tex14	A	G	11: 87,538,623		probably null	Het
Tox4	T	C	14: 52,285,904		probably null	Het
Tyr	A	G	7: 87,437,940	S455P	probably benign	Het
Uggt2	T	C	14: 119,026,433	N1062D	possibly damaging	Het
Umod	A	C	7: 119,476,690	N284K	possibly damaging	Het
Unc93b1	T	C	19: 3,943,572	I338T	probably damaging	Het
Vmn2r99	C	T	17: 19,378,570	T172I	possibly damaging	Het
Whrn	G	A	4: 63,415,639	Q415*	probably null	Het

Other mutations in Ptch1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00567:Ptch1	APN	13	63527175	missense	probably benign	0.00
IGL01084:Ptch1	APN	13	63543637	missense	probably damaging	0.99
IGL01369:Ptch1	APN	13	63511681	missense	probably benign
IGL02260:Ptch1	APN	13	63565352	unclassified	probably benign
IGL02439:Ptch1	APN	13	63545096	missense	probably damaging	1.00
IGL02588:Ptch1	APN	13	63511918	missense	probably benign	0.13
IGL02797:Ptch1	APN	13	63533607	missense	probably benign
R0463:Ptch1	UTSW	13	63520307	missense	probably damaging	0.98
R0539:Ptch1	UTSW	13	63543480	splice site	probably benign
R0657:Ptch1	UTSW	13	63513751	missense	possibly damaging	0.90
R0971:Ptch1	UTSW	13	63539843	missense	probably benign	0.23
R1466:Ptch1	UTSW	13	63524969	missense	probably benign	0.02
R1466:Ptch1	UTSW	13	63524969	missense	probably benign	0.02
R1539:Ptch1	UTSW	13	63541287	missense	probably benign	0.00
R1616:Ptch1	UTSW	13	63539842	missense	possibly damaging	0.96
R1883:Ptch1	UTSW	13	63512027	nonsense	probably null
R1985:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R1986:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2024:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2025:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2026:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2027:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2096:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2097:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2100:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2105:Ptch1	UTSW	13	63545245	missense	probably benign
R2165:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2166:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2167:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2168:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2226:Ptch1	UTSW	13	63513671	missense	probably damaging	1.00
R2437:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2504:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2507:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2696:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2698:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2698:Ptch1	UTSW	13	63542224	missense	probably damaging	1.00
R2971:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3410:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3708:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3744:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3745:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3783:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3784:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3785:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3807:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3950:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4013:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4015:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4017:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4035:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4083:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4084:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4179:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4222:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4348:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4349:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4350:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4351:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4353:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4485:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4595:Ptch1	UTSW	13	63543608	missense	possibly damaging	0.68
R4625:Ptch1	UTSW	13	63523164	missense	probably benign	0.02
R4809:Ptch1	UTSW	13	63513708	missense	probably damaging	0.98
R4904:Ptch1	UTSW	13	63523004	missense	probably damaging	1.00
R4911:Ptch1	UTSW	13	63523052	missense	probably damaging	1.00
R4942:Ptch1	UTSW	13	63525070	missense	probably benign	0.02
R5386:Ptch1	UTSW	13	63545043	missense	probably damaging	0.98
R5447:Ptch1	UTSW	13	63527245	missense	probably benign
R5604:Ptch1	UTSW	13	63525122	missense	probably benign	0.01
R5846:Ptch1	UTSW	13	63565454	unclassified	probably benign
R5926:Ptch1	UTSW	13	63545055	missense	probably benign	0.01
R5945:Ptch1	UTSW	13	63573419	utr 5 prime	probably benign
R5957:Ptch1	UTSW	13	63525115	missense	probably damaging	1.00
R6326:Ptch1	UTSW	13	63543545	missense	probably damaging	1.00
R6358:Ptch1	UTSW	13	63513689	missense	probably damaging	0.96
R6376:Ptch1	UTSW	13	63543608	missense	possibly damaging	0.68
R6599:Ptch1	UTSW	13	63523104	missense	probably damaging	0.98
R6615:Ptch1	UTSW	13	63539830	missense	possibly damaging	0.46
R6965:Ptch1	UTSW	13	63525067	missense	possibly damaging	0.63
R7149:Ptch1	UTSW	13	63511736	missense	probably benign	0.23
R7168:Ptch1	UTSW	13	63512060	missense	probably benign
R7257:Ptch1	UTSW	13	63573294	missense	not run
R7258:Ptch1	UTSW	13	63573294	missense	not run
R7259:Ptch1	UTSW	13	63573294	missense	not run
R7368:Ptch1	UTSW	13	63511984	missense	probably benign	0.06
R7525:Ptch1	UTSW	13	63511714	missense	probably benign	0.00
R7528:Ptch1	UTSW	13	63511714	missense	probably benign	0.00
R7820:Ptch1	UTSW	13	63523061	missense	probably damaging	1.00
R8077:Ptch1	UTSW	13	63540812	missense	probably damaging	0.98
R8373:Ptch1	UTSW	13	63541168	missense	probably damaging	1.00
R8398:Ptch1	UTSW	13	63525125	missense	probably benign	0.06
R8407:Ptch1	UTSW	13	63514243	missense	probably null	1.00
R8839:Ptch1	UTSW	13	63541224	missense	probably damaging	1.00
R9075:Ptch1	UTSW	13	63533521	missense	possibly damaging	0.87
R9476:Ptch1	UTSW	13	63533634	missense	probably benign	0.05
R9514:Ptch1	UTSW	13	63527257	missense	probably benign
R9528:Ptch1	UTSW	13	63513801	missense	probably benign	0.00
R9568:Ptch1	UTSW	13	63542173	missense	probably damaging	0.99
Z1177:Ptch1	UTSW	13	63520279	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CGCTCACTTCTCAACGTGAG -3'
(R):5'- TTGTAGTTGACTAAACAGCGTCTG -3'

Sequencing Primer
(F):5'- GCAGGGCTGTGTTCCATTACAC -3'
(R):5'- TTGACTAAACAGCGTCTGGTAGAC -3'

Posted On

2015-04-29