Incidental Mutation 'R4024:Vangl2'
ID313371
Institutional Source Beutler Lab
Gene Symbol Vangl2
Ensembl Gene ENSMUSG00000026556
Gene NameVANGL planar cell polarity 2
SynonymsC530001F03Rik, Ltap, loop-tail, Lpp1, strabismus, ska, ska17
MMRRC Submission 041612-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4024 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location172000960-172028444 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 172008041 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 355 (S355G)
Ref Sequence ENSEMBL: ENSMUSP00000106895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027837] [ENSMUST00000111263] [ENSMUST00000111264] [ENSMUST00000138714] [ENSMUST00000153662]
Predicted Effect probably benign
Transcript: ENSMUST00000027837
AA Change: S315G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027837
Gene: ENSMUSG00000026556
AA Change: S315G

DomainStartEndE-ValueType
Pfam:Strabismus 22 521 3.1e-267 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111263
AA Change: S315G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106894
Gene: ENSMUSG00000026556
AA Change: S315G

DomainStartEndE-ValueType
Pfam:Strabismus 22 521 3.1e-267 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111264
AA Change: S355G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106895
Gene: ENSMUSG00000026556
AA Change: S355G

DomainStartEndE-ValueType
Pfam:Strabismus 19 272 5e-115 PFAM
Pfam:Strabismus 298 560 1.3e-124 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138714
SMART Domains Protein: ENSMUSP00000117736
Gene: ENSMUSG00000026556

DomainStartEndE-ValueType
Pfam:Strabismus 22 102 2e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148363
Predicted Effect probably benign
Transcript: ENSMUST00000153662
SMART Domains Protein: ENSMUSP00000116522
Gene: ENSMUSG00000026556

DomainStartEndE-ValueType
Pfam:Strabismus 22 130 2.4e-38 PFAM
Meta Mutation Damage Score 0.0707 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein involved in the regulation of planar cell polarity, especially in the stereociliary bundles of the cochlea. The encoded protein transmits directional signals to individual cells or groups of cells in epithelial sheets. This protein is also involved in the development of the neural plate. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous animals do not survive past birth. Developmental defects are seen in the nervous, cardiovascular, skeletal, vestibular, and respiratory systems. Kinked or looped tails are noted in heterozygotes with partial penetrance, along with a head wobble and some nervous system deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,168,477 Y842H probably damaging Het
Adamts9 A G 6: 92,872,784 probably benign Het
Adgrg7 A T 16: 56,730,298 Y684N probably damaging Het
Aoc1 A T 6: 48,908,269 N646I probably damaging Het
Armc2 A G 10: 41,993,058 S37P probably benign Het
Bhmt2 G A 13: 93,663,331 probably benign Het
Bpifb1 A T 2: 154,213,046 D286V probably damaging Het
Cadps T A 14: 12,705,539 E285D probably damaging Het
Cap2 C T 13: 46,637,841 probably benign Het
Clcn4 T G 7: 7,290,428 Y443S probably damaging Het
Clcn6 T A 4: 148,014,283 T463S possibly damaging Het
Cmip A G 8: 117,447,416 I412V possibly damaging Het
Cndp1 T C 18: 84,628,813 D250G probably damaging Het
Colec10 A G 15: 54,462,551 D259G probably damaging Het
Ctnna2 A T 6: 77,636,844 D254E possibly damaging Het
Dlec1 T C 9: 119,137,340 Y1126H probably damaging Het
Dzank1 T C 2: 144,482,227 S565G probably benign Het
Eef2k A G 7: 120,858,598 Y60C probably benign Het
Fam208b T C 13: 3,584,554 D751G probably damaging Het
Fbxl4 T C 4: 22,377,074 V170A possibly damaging Het
Foxk2 T A 11: 121,285,613 I195N possibly damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gpr6 G A 10: 41,071,268 T106M probably damaging Het
Grk3 T A 5: 112,914,984 N666Y possibly damaging Het
Hnmt T C 2: 24,003,765 D239G probably benign Het
Igf2 A G 7: 142,654,307 V111A probably benign Het
Lrriq3 G A 3: 155,188,302 E547K probably benign Het
Lrriq4 T C 3: 30,650,273 V150A possibly damaging Het
Mroh8 A G 2: 157,256,352 V292A probably benign Het
Myo1e A G 9: 70,324,875 I229V probably benign Het
Nisch A G 14: 31,176,819 probably benign Het
Nkx2-2 T C 2: 147,184,234 T195A probably benign Het
Olfr1132 T A 2: 87,635,155 L197F probably damaging Het
Olfr328 G A 11: 58,551,396 T281I possibly damaging Het
Olfr432 C T 1: 174,051,117 T248I probably benign Het
Olfr487 A T 7: 108,211,742 Y262* probably null Het
Plekhn1 A G 4: 156,224,750 V233A probably damaging Het
Ppp3r1 T C 11: 17,194,786 V133A probably damaging Het
Sash1 T C 10: 8,729,917 D903G probably benign Het
Scn8a A G 15: 101,039,793 D1681G probably damaging Het
Slk A G 19: 47,622,370 probably null Het
Tlr11 C T 14: 50,362,846 T763I probably benign Het
Ttbk2 T C 2: 120,760,255 T308A possibly damaging Het
Tyk2 G A 9: 21,115,919 L552F probably damaging Het
Ubp1 A G 9: 113,944,883 D50G probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ulk4 A T 9: 121,044,849 I1172N possibly damaging Het
Usf3 T A 16: 44,216,165 V336E possibly damaging Het
Vmn1r216 A G 13: 23,099,891 D248G probably damaging Het
Vmn1r34 T A 6: 66,637,704 M17L probably benign Het
Vmn2r120 T A 17: 57,536,718 D42V possibly damaging Het
Vmn2r6 A T 3: 64,538,250 S685T possibly damaging Het
Vsig10l T C 7: 43,468,086 V701A probably benign Het
Wdfy3 A G 5: 101,924,095 probably benign Het
Zfp808 T A 13: 62,171,730 C258S possibly damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Vangl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03117:Vangl2 APN 1 172012848 missense probably damaging 1.00
crimp UTSW 1 172006127 missense probably damaging 1.00
Piggy UTSW 1 172009663 missense possibly damaging 0.95
R0594:Vangl2 UTSW 1 172004657 missense probably damaging 1.00
R0718:Vangl2 UTSW 1 172006217 missense probably damaging 1.00
R1162:Vangl2 UTSW 1 172004847 missense probably damaging 1.00
R1173:Vangl2 UTSW 1 172004786 missense probably damaging 1.00
R1174:Vangl2 UTSW 1 172004786 missense probably damaging 1.00
R1175:Vangl2 UTSW 1 172004786 missense probably damaging 1.00
R1857:Vangl2 UTSW 1 172009897 missense probably damaging 0.99
R2290:Vangl2 UTSW 1 172008546 nonsense probably null
R2421:Vangl2 UTSW 1 172007959 missense probably damaging 1.00
R4809:Vangl2 UTSW 1 172009663 missense possibly damaging 0.95
R4980:Vangl2 UTSW 1 172009565 missense probably damaging 1.00
R5761:Vangl2 UTSW 1 172006127 missense probably damaging 1.00
R8053:Vangl2 UTSW 1 172004736 missense probably damaging 1.00
R8297:Vangl2 UTSW 1 172009946 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GGTACCACTCAGTTGGCTTTTC -3'
(R):5'- TGCAAAACCTCCTGCATCAG -3'

Sequencing Primer
(F):5'- GGCTTTTCCCCTCCCTCAGG -3'
(R):5'- ATGCAGAATTCCTCCCCTTTCAATG -3'
Posted On2015-04-30