Incidental Mutation 'R8297:Vangl2'
ID638992
Institutional Source Beutler Lab
Gene Symbol Vangl2
Ensembl Gene ENSMUSG00000026556
Gene NameVANGL planar cell polarity 2
SynonymsC530001F03Rik, Ltap, loop-tail, Lpp1, strabismus, ska, ska17
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8297 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location172000960-172028444 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 172009946 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 99 (V99F)
Ref Sequence ENSEMBL: ENSMUSP00000106895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027837] [ENSMUST00000111263] [ENSMUST00000111264] [ENSMUST00000138714] [ENSMUST00000153662]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027837
AA Change: V99F

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027837
Gene: ENSMUSG00000026556
AA Change: V99F

DomainStartEndE-ValueType
Pfam:Strabismus 22 521 3.1e-267 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111263
AA Change: V99F

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106894
Gene: ENSMUSG00000026556
AA Change: V99F

DomainStartEndE-ValueType
Pfam:Strabismus 22 521 3.1e-267 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111264
AA Change: V99F

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106895
Gene: ENSMUSG00000026556
AA Change: V99F

DomainStartEndE-ValueType
Pfam:Strabismus 19 272 5e-115 PFAM
Pfam:Strabismus 298 560 1.3e-124 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000138714
AA Change: V99F

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117736
Gene: ENSMUSG00000026556
AA Change: V99F

DomainStartEndE-ValueType
Pfam:Strabismus 22 102 2e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000153662
AA Change: V99F

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000116522
Gene: ENSMUSG00000026556
AA Change: V99F

DomainStartEndE-ValueType
Pfam:Strabismus 22 130 2.4e-38 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein involved in the regulation of planar cell polarity, especially in the stereociliary bundles of the cochlea. The encoded protein transmits directional signals to individual cells or groups of cells in epithelial sheets. This protein is also involved in the development of the neural plate. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous animals do not survive past birth. Developmental defects are seen in the nervous, cardiovascular, skeletal, vestibular, and respiratory systems. Kinked or looped tails are noted in heterozygotes with partial penetrance, along with a head wobble and some nervous system deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T C 10: 21,621,679 L73P probably damaging Het
4933412E24Rik T G 15: 60,015,675 R305S probably damaging Het
Adamts19 T A 18: 58,837,848 V168E probably damaging Het
Ankrd34b T A 13: 92,439,589 L443Q probably damaging Het
Ano3 A G 2: 110,661,271 Y887H probably damaging Het
Arhgef2 A T 3: 88,639,432 H553L probably benign Het
Atxn1 G T 13: 45,567,029 N463K probably benign Het
Birc6 A G 17: 74,625,104 probably null Het
C4bp A G 1: 130,636,745 S401P probably damaging Het
Cd5 T A 19: 10,720,245 R457W probably damaging Het
Chek2 T G 5: 110,848,436 Y127D probably damaging Het
Clec4a1 G A 6: 122,922,001 V10M probably damaging Het
Cltc A G 11: 86,712,631 Y790H probably damaging Het
Cops2 T C 2: 125,859,108 probably benign Het
Cyb5d2 A G 11: 72,789,103 F122S probably damaging Het
Daam1 T A 12: 71,951,915 L548H unknown Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Dsg1a A C 18: 20,332,033 N427T probably benign Het
Ear14 A T 14: 51,204,107 D140V probably damaging Het
Epha4 A C 1: 77,506,910 F154C probably damaging Het
Ets2 G A 16: 95,706,454 V12M probably damaging Het
Fbxo40 G A 16: 36,969,308 T480I probably damaging Het
Fdps A T 3: 89,093,741 Y322N probably damaging Het
Gca T C 2: 62,686,356 M132T probably benign Het
Ifi203 T G 1: 173,937,930 K26T probably damaging Het
Itga10 A G 3: 96,654,800 R668G probably damaging Het
Itgal T C 7: 127,330,466 I1185T unknown Het
Kcnj13 A T 1: 87,386,467 N344K probably damaging Het
Kdm5a A T 6: 120,381,555 L186F probably benign Het
Klhl8 T C 5: 103,863,088 N624D probably benign Het
Klrb1 G T 6: 128,712,259 T83K possibly damaging Het
Krt77 TGCCGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGCCGC 15: 101,859,972 probably benign Het
Ltb G T 17: 35,194,679 R53L probably benign Het
Mterf3 A G 13: 66,907,158 V69A Het
Mvb12a A G 8: 71,545,244 K101E probably damaging Het
Nbeal2 T A 9: 110,635,341 Q1110L possibly damaging Het
Neb T A 2: 52,308,763 T389S possibly damaging Het
Nol4 A G 18: 23,040,012 F11L probably damaging Het
Olfr132 A G 17: 38,130,593 S200P probably damaging Het
Olfr441 A G 6: 43,116,506 I255V probably benign Het
Olfr675 C T 7: 105,024,678 G97R probably benign Het
Olfr9 T C 10: 128,990,839 L309P possibly damaging Het
Pde2a T A 7: 101,504,673 Y487N possibly damaging Het
Pde4a C T 9: 21,166,108 P61S possibly damaging Het
Pramef25 T A 4: 143,949,120 T379S probably benign Het
Prr5l A G 2: 101,741,285 probably null Het
Ptpn6 G A 6: 124,728,651 T179I possibly damaging Het
Ralyl T C 3: 14,039,776 S34P probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Robo2 A T 16: 74,015,926 C293* probably null Het
Rtn4 T G 11: 29,705,536 D169E probably damaging Het
Slc22a22 A T 15: 57,259,110 V157E probably damaging Het
Sytl2 A G 7: 90,385,075 T498A probably benign Het
Tgm6 G A 2: 130,137,438 V163I probably benign Het
Tnpo3 A T 6: 29,582,303 C187S possibly damaging Het
Ttn A G 2: 76,786,141 probably null Het
Vmn1r167 C T 7: 23,504,790 C267Y probably damaging Het
Vsig10l T C 7: 43,464,107 V161A possibly damaging Het
Xrcc5 G A 1: 72,325,085 R232Q possibly damaging Het
Xrcc6 C G 15: 82,029,262 F365L probably damaging Het
Zcchc11 G A 4: 108,479,708 A210T possibly damaging Het
Zdhhc13 A G 7: 48,815,509 Y389C probably damaging Het
Other mutations in Vangl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03117:Vangl2 APN 1 172012848 missense probably damaging 1.00
crimp UTSW 1 172006127 missense probably damaging 1.00
Piggy UTSW 1 172009663 missense possibly damaging 0.95
R0594:Vangl2 UTSW 1 172004657 missense probably damaging 1.00
R0718:Vangl2 UTSW 1 172006217 missense probably damaging 1.00
R1162:Vangl2 UTSW 1 172004847 missense probably damaging 1.00
R1173:Vangl2 UTSW 1 172004786 missense probably damaging 1.00
R1174:Vangl2 UTSW 1 172004786 missense probably damaging 1.00
R1175:Vangl2 UTSW 1 172004786 missense probably damaging 1.00
R1857:Vangl2 UTSW 1 172009897 missense probably damaging 0.99
R2290:Vangl2 UTSW 1 172008546 nonsense probably null
R2421:Vangl2 UTSW 1 172007959 missense probably damaging 1.00
R4024:Vangl2 UTSW 1 172008041 missense probably benign 0.00
R4809:Vangl2 UTSW 1 172009663 missense possibly damaging 0.95
R4980:Vangl2 UTSW 1 172009565 missense probably damaging 1.00
R5761:Vangl2 UTSW 1 172006127 missense probably damaging 1.00
R8053:Vangl2 UTSW 1 172004736 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCAGGATGAGCAGCTTG -3'
(R):5'- AGCTCAGTGACTTCTGATGACTG -3'

Sequencing Primer
(F):5'- TGAGCAGCTTGAAGGCCAC -3'
(R):5'- CAGTGACTTCTGATGACTGTATATG -3'
Posted On2020-07-28