Incidental Mutation 'R4067:Wdr34'
ID316146
Institutional Source Beutler Lab
Gene Symbol Wdr34
Ensembl Gene ENSMUSG00000039715
Gene NameWD repeat domain 34
Synonyms
MMRRC Submission 040853-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R4067 (G1)
Quality Score203
Status Validated
Chromosome2
Chromosomal Location30031546-30048881 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30032808 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 309 (L309P)
Ref Sequence ENSEMBL: ENSMUSP00000109340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046257] [ENSMUST00000095083] [ENSMUST00000100225] [ENSMUST00000113711] [ENSMUST00000113717] [ENSMUST00000113719] [ENSMUST00000129241]
Predicted Effect probably benign
Transcript: ENSMUST00000046257
SMART Domains Protein: ENSMUSP00000047792
Gene: ENSMUSG00000057738

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1635 9.65e-30 SMART
SPEC 1641 1741 2.32e-32 SMART
SPEC 1747 1847 6.98e-36 SMART
SPEC 1853 1953 1.53e-32 SMART
SPEC 1959 2060 6.23e-24 SMART
SPEC 2074 2174 2.08e-11 SMART
SPEC 2188 2289 1.07e-4 SMART
EFh 2307 2335 5.78e-7 SMART
EFh 2350 2378 3.85e-3 SMART
efhand_Ca_insen 2382 2451 6.74e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095083
SMART Domains Protein: ENSMUSP00000092697
Gene: ENSMUSG00000057738

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1088 1.56e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1094 1230 6.52e-27 SMART
SPEC 1236 1336 1.44e-37 SMART
SPEC 1342 1442 4.43e-29 SMART
SPEC 1448 1548 7.54e-32 SMART
SPEC 1554 1655 9.65e-30 SMART
SPEC 1661 1761 2.32e-32 SMART
SPEC 1767 1867 6.98e-36 SMART
SPEC 1873 1973 1.53e-32 SMART
SPEC 1979 2080 6.23e-24 SMART
SPEC 2094 2194 2.08e-11 SMART
SPEC 2208 2309 1.07e-4 SMART
EFh 2327 2355 5.78e-7 SMART
EFh 2370 2398 3.85e-3 SMART
efhand_Ca_insen 2402 2471 6.74e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100225
SMART Domains Protein: ENSMUSP00000097797
Gene: ENSMUSG00000057738

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1088 1.56e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1094 1230 6.52e-27 SMART
SPEC 1236 1336 1.44e-37 SMART
SPEC 1342 1442 4.43e-29 SMART
SPEC 1448 1548 7.54e-32 SMART
SPEC 1554 1660 2.06e-24 SMART
SPEC 1666 1766 2.32e-32 SMART
SPEC 1772 1872 6.98e-36 SMART
SPEC 1878 1978 1.53e-32 SMART
SPEC 1984 2085 6.23e-24 SMART
SPEC 2099 2199 2.08e-11 SMART
SPEC 2213 2314 1.07e-4 SMART
EFh 2332 2360 5.78e-7 SMART
EFh 2375 2403 3.85e-3 SMART
efhand_Ca_insen 2407 2476 6.74e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113711
AA Change: L309P

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000109340
Gene: ENSMUSG00000039715
AA Change: L309P

DomainStartEndE-ValueType
low complexity region 11 36 N/A INTRINSIC
low complexity region 90 100 N/A INTRINSIC
Blast:WD40 146 200 3e-28 BLAST
WD40 207 247 2e-1 SMART
WD40 256 300 3.42e1 SMART
Blast:WD40 323 364 8e-10 BLAST
WD40 382 422 1.66e-5 SMART
WD40 425 465 3.09e-1 SMART
WD40 470 512 4.18e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113717
SMART Domains Protein: ENSMUSP00000109346
Gene: ENSMUSG00000057738

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1640 2.06e-24 SMART
SPEC 1646 1746 2.32e-32 SMART
SPEC 1752 1852 6.98e-36 SMART
SPEC 1858 1958 1.53e-32 SMART
SPEC 1964 2065 6.23e-24 SMART
SPEC 2079 2179 2.08e-11 SMART
SPEC 2193 2294 1.07e-4 SMART
EFh 2312 2340 5.78e-7 SMART
EFh 2355 2383 3.85e-3 SMART
efhand_Ca_insen 2387 2456 6.74e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113719
SMART Domains Protein: ENSMUSP00000109348
Gene: ENSMUSG00000057738

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1640 2.06e-24 SMART
SPEC 1646 1746 2.32e-32 SMART
SPEC 1752 1852 6.98e-36 SMART
SPEC 1858 1958 1.53e-32 SMART
SPEC 1964 2065 6.23e-24 SMART
SPEC 2079 2179 2.08e-11 SMART
SPEC 2193 2315 3.27e0 SMART
EFh 2333 2361 5.78e-7 SMART
EFh 2376 2404 3.85e-3 SMART
efhand_Ca_insen 2408 2477 6.74e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124494
Predicted Effect probably benign
Transcript: ENSMUST00000129241
SMART Domains Protein: ENSMUSP00000121116
Gene: ENSMUSG00000057738

DomainStartEndE-ValueType
Pfam:Spectrin 1 65 9.9e-10 PFAM
SPEC 78 178 2.08e-11 SMART
SPEC 192 314 3.27e0 SMART
EFh 332 360 5.78e-7 SMART
EFh 375 403 3.85e-3 SMART
efhand_Ca_insen 407 476 6.74e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143892
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201758
Meta Mutation Damage Score 0.5475 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Defects in this gene are a cause of short-rib thoracic dysplasia 11 with or without polydactyly. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025G04Rik T A 1: 151,893,399 T121S possibly damaging Het
4930503E14Rik T C 14: 44,169,184 E136G probably damaging Het
Adgrg4 A G X: 56,959,960 N2527S probably damaging Het
Ak1 G A 2: 32,629,581 S7N probably benign Het
Aktip A C 8: 91,125,838 I230R possibly damaging Het
Alms1 A G 6: 85,621,289 I1032M probably damaging Het
Asb4 T A 6: 5,423,651 V266E probably damaging Het
Bace1 G A 9: 45,854,664 V130M probably damaging Het
BC017643 A T 11: 121,224,702 probably null Het
Bglap A T 3: 88,384,437 probably benign Het
Brpf3 T C 17: 28,821,259 S885P probably benign Het
Chd9 A T 8: 91,023,574 I1742F possibly damaging Het
Col9a2 T A 4: 121,052,389 I415N probably damaging Het
Dnajc7 T C 11: 100,601,781 Y38C probably benign Het
Enam A G 5: 88,503,377 Y840C probably damaging Het
Etnppl T A 3: 130,631,793 C416S probably damaging Het
Fgf20 A T 8: 40,279,855 S181T probably benign Het
Fut8 T A 12: 77,464,061 Y421N probably damaging Het
Gcn1l1 T G 5: 115,599,088 L1295R probably damaging Het
Gm11437 A G 11: 84,164,511 V93A probably benign Het
Gm1966 T A 7: 106,599,565 noncoding transcript Het
Gm597 T A 1: 28,777,631 D440V probably damaging Het
Gm9989 T C 3: 81,922,242 noncoding transcript Het
Gsdmc4 A T 15: 63,893,887 probably null Het
Ighv10-1 A T 12: 114,479,023 M114K probably benign Het
Iltifb T C 10: 118,290,210 I161V probably damaging Het
Itfg2 T A 6: 128,410,450 probably benign Het
Kirrel G A 3: 87,088,467 Q387* probably null Het
Klk1 C T 7: 44,227,544 R24* probably null Het
Klra7 T C 6: 130,231,649 probably null Het
Ltn1 T C 16: 87,416,230 Y481C possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mrps2 A G 2: 28,469,770 N213S probably benign Het
Muc4 A T 16: 32,751,051 I310F possibly damaging Het
Ntrk3 T A 7: 78,517,437 Y102F probably damaging Het
Olfr1058 A T 2: 86,386,087 C110* probably null Het
Otof C T 5: 30,399,291 G282D probably damaging Het
Pcdhb2 A T 18: 37,297,314 probably null Het
Pign A T 1: 105,587,978 probably null Het
Plekha6 G A 1: 133,294,678 E1001K probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Ppm1d A G 11: 85,345,852 T486A probably benign Het
Pudp A G 18: 50,568,258 F135L probably benign Het
Rd3l T G 12: 111,979,511 N178T probably benign Het
Rel A C 11: 23,753,215 probably null Het
Sf3a1 T A 11: 4,167,824 F195L probably damaging Het
Slc30a1 G C 1: 191,907,289 A95P probably damaging Het
Slc47a2 T C 11: 61,303,947 T469A probably benign Het
Slc4a10 A T 2: 62,046,645 M1L probably benign Het
Slc8a1 T A 17: 81,648,274 D445V probably damaging Het
Slc9a7 C T X: 20,205,554 G113R probably damaging Het
Spic T C 10: 88,675,683 H237R possibly damaging Het
Stk26 A G X: 50,889,033 E317G probably benign Het
Tex10 A T 4: 48,459,355 Y506* probably null Het
Trhde T A 10: 114,444,680 R848* probably null Het
Trpc5 T A X: 144,419,598 R545* probably null Het
Usp24 C T 4: 106,359,089 T379M possibly damaging Het
Zfp783 A T 6: 47,945,565 noncoding transcript Het
Other mutations in Wdr34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02007:Wdr34 APN 2 30038390 missense probably benign 0.11
IGL02165:Wdr34 APN 2 30032160 missense probably benign
IGL02600:Wdr34 APN 2 30033302 missense possibly damaging 0.65
PIT1430001:Wdr34 UTSW 2 30032135 missense probably damaging 1.00
R0542:Wdr34 UTSW 2 30031825 missense probably damaging 0.98
R4065:Wdr34 UTSW 2 30032808 missense probably benign 0.03
R4750:Wdr34 UTSW 2 30033920 missense probably benign 0.00
R4907:Wdr34 UTSW 2 30032460 unclassified probably null
R5008:Wdr34 UTSW 2 30032769 missense probably benign 0.14
R5253:Wdr34 UTSW 2 30032363 unclassified probably benign
R6014:Wdr34 UTSW 2 30031751 missense probably benign 0.01
R6456:Wdr34 UTSW 2 30032767 missense probably benign 0.01
R6789:Wdr34 UTSW 2 30033272 critical splice donor site probably null
R7024:Wdr34 UTSW 2 30038266 missense possibly damaging 0.61
R7319:Wdr34 UTSW 2 30038329 missense probably benign 0.00
R7576:Wdr34 UTSW 2 30048778 missense probably benign 0.00
R7640:Wdr34 UTSW 2 30031768 missense probably benign 0.00
R8025:Wdr34 UTSW 2 30048718 missense probably benign 0.00
R8111:Wdr34 UTSW 2 30031847 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TGGAGAAGGCCACTGATGTC -3'
(R):5'- ATTCTTTACTCTTACAGCTGGGG -3'

Sequencing Primer
(F):5'- ACCTCAGTCTCTCCACGGG -3'
(R):5'- GGGGGTGAGGCTGATACTG -3'
Posted On2015-05-15