Mutagenetix > Incidental Mutation

Incidental Mutation 'R4081:Ifit1bl1'

316906

Institutional Source

Beutler Lab

Gene Symbol

Ifit1bl1

Ensembl Gene

ENSMUSG00000079339

Gene Name

interferon induced protein with tetratricpeptide repeats 1B like 1

Synonyms

Gm14446

MMRRC Submission

040977-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4081 (G1)

Quality Score

152

Status

Validated

Chromosome

Chromosomal Location

34592888-34601968 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 34594640 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 139 (Y139C)

Ref Sequence

ENSEMBL: ENSMUSP00000132781 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112467] [ENSMUST00000168254]

AlphaFold

D3Z6F0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112467
AA Change: Y139C

PolyPhen 2 Score 0.634 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000108086
Gene: ENSMUSG00000079339
AA Change: Y139C

Domain	Start	End	E-Value	Type
TPR	60	93	3.41e1	SMART
TPR	100	133	6.24e1	SMART
TPR	146	179	3.69e1	SMART
low complexity region	217	231	N/A	INTRINSIC
TPR	249	282	6.75e1	SMART
TPR	338	371	1.64e1	SMART
low complexity region	417	429	N/A	INTRINSIC
TPR	433	466	1.08e1	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168254
AA Change: Y139C

PolyPhen 2 Score 0.634 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000132781
Gene: ENSMUSG00000079339
AA Change: Y139C

Domain	Start	End	E-Value	Type
TPR	60	93	3.41e1	SMART
TPR	100	133	6.24e1	SMART
TPR	146	179	3.69e1	SMART
low complexity region	217	231	N/A	INTRINSIC
TPR	249	282	6.75e1	SMART
TPR	338	371	1.64e1	SMART
low complexity region	417	429	N/A	INTRINSIC
TPR	433	466	1.08e1	SMART

Meta Mutation Damage Score

0.7691

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 96.0%

Validation Efficiency

98% (58/59)

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110008L16Rik	G	T	12: 55,304,613	V236F	possibly damaging	Het
Aass	A	T	6: 23,109,498	D324E	possibly damaging	Het
Adad1	A	G	3: 37,064,363		probably null	Het
Aim2	T	C	1: 173,459,851		probably null	Het
Arhgef1	G	T	7: 24,925,846	D850Y	probably damaging	Het
Ccnf	T	C	17: 24,223,898	*778W	probably null	Het
Cd53	T	C	3: 106,762,145	H179R	probably benign	Het
Cit	G	T	5: 115,948,050	R891L	probably damaging	Het
Clec4b1	T	C	6: 123,069,774		probably null	Het
Cntrl	C	A	2: 35,161,926		probably benign	Het
Cntrl	A	G	2: 35,175,125	D2148G	probably damaging	Het
Cpa5	T	C	6: 30,631,229	S381P	probably benign	Het
Crybg1	A	T	10: 43,975,039	V1612D	probably damaging	Het
Cwc25	G	T	11: 97,753,918	Q205K	probably benign	Het
Cyp2d11	A	T	15: 82,391,801	I193N	possibly damaging	Het
Gdi2	T	A	13: 3,548,866	C17S	probably benign	Het
Gm5436	T	A	12: 84,258,715		noncoding transcript	Het
Insr	A	T	8: 3,211,391	M321K	probably benign	Het
Ippk	T	A	13: 49,446,376	L237Q	probably damaging	Het
Itpr1	T	A	6: 108,391,835	I149N	probably damaging	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906	74	probably benign	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lrp2	T	A	2: 69,513,273	H914L	probably damaging	Het
Myd88	G	T	9: 119,339,987		probably benign	Het
Myh2	T	C	11: 67,190,430	S1291P	probably benign	Het
Mylk3	G	A	8: 85,328,682	L549F	probably damaging	Het
Otog	T	C	7: 46,288,299	S1811P	possibly damaging	Het
Phrf1	T	C	7: 141,259,057		probably benign	Het
Plod3	G	C	5: 136,988,146	A50P	probably benign	Het
Ptprh	T	A	7: 4,580,988	T202S	probably damaging	Het
Ptprr	A	T	10: 116,236,710	K329N	probably benign	Het
Rgl3	T	A	9: 21,987,675	H156L	possibly damaging	Het
Sema6b	A	G	17: 56,128,307	V312A	probably damaging	Het
Sez6l	T	C	5: 112,461,166	I606V	probably benign	Het
Slco1a1	T	C	6: 141,935,962	E148G	probably damaging	Het
Snph	T	C	2: 151,593,802	D402G	probably damaging	Het
Sohlh1	A	G	2: 25,845,722	V135A	probably benign	Het
Sox14	T	C	9: 99,875,224	E154G	possibly damaging	Het
Spta1	A	G	1: 174,214,066	D1334G	probably benign	Het
Stard13	C	A	5: 151,092,829		probably null	Het
Szt2	A	G	4: 118,373,567		probably benign	Het
Tab2	G	A	10: 7,919,831	P296S	probably damaging	Het
Tbx15	A	G	3: 99,313,054	D48G	possibly damaging	Het
Tex10	T	C	4: 48,468,873	S101G	probably benign	Het
Tex11	C	A	X: 100,933,415	A487S	possibly damaging	Het
Tulp4	C	T	17: 6,231,780	H695Y	probably damaging	Het
Vmn1r66	A	G	7: 10,274,806	I100T	probably damaging	Het
Vmn2r106	A	T	17: 20,267,556	Y860*	probably null	Het
Vwa3b	C	T	1: 37,035,824	T24I	probably damaging	Het
Zfp541	G	A	7: 16,072,135	S65N	probably benign	Het
Zfp992	C	T	4: 146,467,519	H566Y	probably damaging	Het

Other mutations in Ifit1bl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
PIT4544001:Ifit1bl1	UTSW	19	34594015	missense	possibly damaging	0.79
R0420:Ifit1bl1	UTSW	19	34594514	missense	probably damaging	1.00
R1161:Ifit1bl1	UTSW	19	34593696	missense	possibly damaging	0.80
R1310:Ifit1bl1	UTSW	19	34593696	missense	possibly damaging	0.80
R1483:Ifit1bl1	UTSW	19	34594641	missense	possibly damaging	0.88
R1606:Ifit1bl1	UTSW	19	34594044	missense	probably benign	0.00
R1753:Ifit1bl1	UTSW	19	34593860	missense	probably benign	0.15
R1778:Ifit1bl1	UTSW	19	34594193	missense	probably damaging	1.00
R2204:Ifit1bl1	UTSW	19	34594341	missense	probably benign	0.23
R2205:Ifit1bl1	UTSW	19	34594341	missense	probably benign	0.23
R2442:Ifit1bl1	UTSW	19	34594889	missense	probably benign	0.00
R2858:Ifit1bl1	UTSW	19	34594322	missense	probably benign	0.01
R3422:Ifit1bl1	UTSW	19	34593950	missense	probably benign	0.04
R4125:Ifit1bl1	UTSW	19	34594788	missense	probably damaging	0.99
R4616:Ifit1bl1	UTSW	19	34594610	missense	probably damaging	1.00
R4731:Ifit1bl1	UTSW	19	34594321	missense	probably benign	0.02
R4732:Ifit1bl1	UTSW	19	34594321	missense	probably benign	0.02
R4849:Ifit1bl1	UTSW	19	34594676	missense	probably damaging	1.00
R5026:Ifit1bl1	UTSW	19	34593893	missense	probably damaging	1.00
R5049:Ifit1bl1	UTSW	19	34594081	nonsense	probably null
R5414:Ifit1bl1	UTSW	19	34593924	missense	probably damaging	0.99
R5561:Ifit1bl1	UTSW	19	34593797	nonsense	probably null
R5586:Ifit1bl1	UTSW	19	34594277	missense	probably damaging	0.98
R6345:Ifit1bl1	UTSW	19	34594170	nonsense	probably null
R6382:Ifit1bl1	UTSW	19	34594883	missense	probably benign	0.16
R6515:Ifit1bl1	UTSW	19	34594499	missense	probably damaging	1.00
R7073:Ifit1bl1	UTSW	19	34599267	critical splice donor site	probably null
R7180:Ifit1bl1	UTSW	19	34593902	missense	probably damaging	1.00
R7210:Ifit1bl1	UTSW	19	34594164	missense	probably benign	0.00
R7665:Ifit1bl1	UTSW	19	34594883	missense	probably benign	0.16
R7724:Ifit1bl1	UTSW	19	34594005	missense	probably benign	0.00
R7783:Ifit1bl1	UTSW	19	34593936	missense	probably benign	0.01
R7944:Ifit1bl1	UTSW	19	34593824	missense	probably benign	0.00
R8251:Ifit1bl1	UTSW	19	34594832	missense	possibly damaging	0.85
R8427:Ifit1bl1	UTSW	19	34599266	critical splice donor site	probably null
R8474:Ifit1bl1	UTSW	19	34594862	missense	probably damaging	1.00
R8933:Ifit1bl1	UTSW	19	34594013	missense	probably damaging	0.99
R9095:Ifit1bl1	UTSW	19	34594499	missense	probably damaging	1.00
R9282:Ifit1bl1	UTSW	19	34594508	missense	probably benign	0.28
R9314:Ifit1bl1	UTSW	19	34599293	missense	probably benign	0.08
R9432:Ifit1bl1	UTSW	19	34594098	missense	possibly damaging	0.86

Predicted Primers

PCR Primer
(F):5'- TGGTTTTACGCTGACAGCC -3'
(R):5'- AGCCCTGCAGAGCTTGAAAG -3'

Sequencing Primer
(F):5'- GCGAAGTGCCATCAATGTGATCC -3'
(R):5'- CTTGAAAGAAGCTGAAGCCTTGATCC -3'

Posted On

2015-05-15