Incidental Mutation 'R0391:Soat2'
ID31728
Institutional Source Beutler Lab
Gene Symbol Soat2
Ensembl Gene ENSMUSG00000023045
Gene Namesterol O-acyltransferase 2
SynonymsACAT2, D15Wsu97e
MMRRC Submission 038597-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R0391 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location102150526-102163469 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 102158753 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 320 (R320S)
Ref Sequence ENSEMBL: ENSMUSP00000023806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023806]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023806
AA Change: R320S

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000023806
Gene: ENSMUSG00000023045
AA Change: R320S

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
transmembrane domain 121 143 N/A INTRINSIC
Pfam:MBOAT 147 497 3.3e-61 PFAM
Predicted Effect silent
Transcript: ENSMUST00000160465
SMART Domains Protein: ENSMUSP00000124628
Gene: ENSMUSG00000023045

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
transmembrane domain 92 114 N/A INTRINSIC
transmembrane domain 134 156 N/A INTRINSIC
transmembrane domain 163 185 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
Meta Mutation Damage Score 0.2340 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency 97% (97/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Summary:This gene is a member of a small family of acyl coenzyme A:cholesterol acyltransferases. The gene encodes a membrane-bound enzyme localized in the endoplasmic reticulum that produces intracellular cholesterol esters from long-chain fatty acyl CoA and cholesterol. The cholesterol esters are then stored as cytoplasmic lipid droplets inside the cell. The enzyme is implicated in cholesterol absorption in the intestine and in the assembly and secretion of apolipoprotein B-containing lipoproteins such as very low density lipoprotein (VLDL). Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant animals exhibit elevated serum triglyceride levels and are resistant to fatty liver, hyperlipidemia, and gallstone development when fed a high fat, high cholesterol diet. When fed a Western diet homozygous mutant animals exhibit elevated HDL levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik T A 4: 122,701,177 probably benign Het
Abcc2 G A 19: 43,821,605 probably benign Het
Abcc8 C G 7: 46,122,173 G838A probably damaging Het
Akr1c21 G A 13: 4,581,200 A245T probably damaging Het
Anapc15-ps T C 10: 95,673,277 E47G probably damaging Het
Apoa1 A G 9: 46,229,842 T79A probably benign Het
Atp6v1b1 A G 6: 83,756,921 H378R possibly damaging Het
C4b A G 17: 34,735,614 probably benign Het
Catsperd A T 17: 56,662,821 E638D probably benign Het
Cckar C T 5: 53,706,253 probably null Het
Cfap100 C T 6: 90,405,339 probably benign Het
Chd1 G T 17: 15,749,894 G970C probably damaging Het
Col14a1 A G 15: 55,446,259 probably benign Het
Col17a1 C T 19: 47,663,824 V698M probably damaging Het
Cpeb1 T C 7: 81,361,725 D156G possibly damaging Het
Cryl1 A G 14: 57,303,775 Y151H possibly damaging Het
Csmd3 C A 15: 47,657,573 V1881L probably damaging Het
Ctnnal1 C T 4: 56,847,921 A73T probably damaging Het
Cyp2c37 T C 19: 39,994,506 S180P probably damaging Het
Cyp2c54 T C 19: 40,072,169 T123A possibly damaging Het
Dennd6b T C 15: 89,187,214 D304G probably damaging Het
Dnmt3l T C 10: 78,051,916 probably benign Het
Eci1 G A 17: 24,433,260 probably null Het
Efhc1 A G 1: 20,960,188 Y115C probably damaging Het
Ern1 T A 11: 106,407,178 K706* probably null Het
Fam129c T A 8: 71,602,499 probably benign Het
Ghrl T C 6: 113,719,338 E31G probably damaging Het
Gpr108 A C 17: 57,243,101 V179G probably benign Het
Henmt1 A G 3: 108,958,535 probably benign Het
Ift172 A G 5: 31,286,667 V69A probably damaging Het
Il17ra T C 6: 120,476,979 probably benign Het
Il17rb T C 14: 30,004,347 N95D probably benign Het
Il17rb G T 14: 30,006,155 probably null Het
Iqub G A 6: 24,446,155 L757F probably benign Het
Itpr1 T C 6: 108,378,167 V473A probably benign Het
Itpr2 T G 6: 146,229,773 N1978H probably damaging Het
Klk1b26 T A 7: 44,012,727 F3Y probably damaging Het
Lars A G 18: 42,251,363 V50A probably benign Het
Lax1 G T 1: 133,680,066 H312Q probably benign Het
Lctl T C 9: 64,122,314 probably benign Het
Lrp2 G A 2: 69,460,337 probably benign Het
Lrp2 T A 2: 69,456,858 D3745V probably damaging Het
Lvrn A T 18: 46,850,466 H92L probably benign Het
March1 A G 8: 66,418,973 T385A probably damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mbd5 T C 2: 49,272,416 V970A possibly damaging Het
Mccc1 A G 3: 35,963,570 probably benign Het
Mpp4 A T 1: 59,143,829 probably benign Het
Mrnip G A 11: 50,199,920 A304T probably damaging Het
Muc5b T C 7: 141,865,082 S3922P possibly damaging Het
Myh3 T A 11: 67,096,507 probably benign Het
Nbea A T 3: 56,037,277 H555Q probably damaging Het
Nlrp9c A T 7: 26,371,476 probably benign Het
Nmur1 A T 1: 86,387,678 V178E probably damaging Het
Nod2 T G 8: 88,663,778 S238A probably benign Het
Ogfod1 A T 8: 94,063,023 T451S probably damaging Het
Olfr145 G A 9: 37,897,842 G146D probably benign Het
Olfr23 T C 11: 73,941,109 F288L probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr716 T A 7: 107,148,187 Y290* probably null Het
Pcdh20 T C 14: 88,468,668 I399V probably benign Het
Pdlim1 G T 19: 40,243,573 H120Q probably damaging Het
Plg T C 17: 12,419,081 V798A probably damaging Het
Polr2c A G 8: 94,857,775 I39V possibly damaging Het
Ppfia2 C A 10: 106,830,714 probably benign Het
Ppp1r3a A T 6: 14,719,697 I406N probably benign Het
Psg28 A T 7: 18,426,173 M366K probably benign Het
Rad54b T C 4: 11,601,702 I419T probably damaging Het
Rnf43 A G 11: 87,731,282 Q403R possibly damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Slc28a3 A G 13: 58,569,415 probably benign Het
Smad2 A T 18: 76,289,037 probably null Het
Smad4 G A 18: 73,658,649 P274S probably benign Het
Smchd1 A T 17: 71,403,154 V906D probably damaging Het
Spata33 C T 8: 123,221,887 A57V probably damaging Het
Stab1 A G 14: 31,143,418 L1814P probably benign Het
Stab2 T C 10: 86,947,144 K680R probably benign Het
Stil A G 4: 115,041,172 probably null Het
Sympk T A 7: 19,046,849 L759H probably benign Het
Tet1 A T 10: 62,814,546 probably null Het
Tfpi2 A T 6: 3,965,460 N117K probably benign Het
Tle3 A G 9: 61,416,661 Y766C probably damaging Het
Trpt1 C A 19: 6,997,930 probably null Het
Tshz1 A G 18: 84,016,049 F78S possibly damaging Het
Ttc1 T C 11: 43,738,808 D177G probably damaging Het
Ttc13 T A 8: 124,674,401 Y741F probably damaging Het
Ulk3 C T 9: 57,594,832 S462L probably benign Het
Utrn C T 10: 12,525,333 probably benign Het
V1rd19 A C 7: 24,003,585 T159P probably damaging Het
Vars T C 17: 35,011,486 V515A possibly damaging Het
Vmn1r85 A G 7: 13,084,588 Y210H probably benign Het
Vmn2r89 A G 14: 51,455,978 T262A probably damaging Het
Vps53 G A 11: 76,121,579 T209I probably benign Het
Wdfy2 T C 14: 62,925,133 F95L possibly damaging Het
Wwp1 G T 4: 19,627,911 S694Y probably damaging Het
Zbtb8b T A 4: 129,432,670 D201V probably damaging Het
Zmym5 A C 14: 56,804,451 N123K possibly damaging Het
Other mutations in Soat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02458:Soat2 APN 15 102162115 missense probably damaging 0.96
IGL03093:Soat2 APN 15 102157643 missense probably damaging 1.00
R0091:Soat2 UTSW 15 102158139 missense probably damaging 1.00
R0396:Soat2 UTSW 15 102150707 unclassified probably benign
R1078:Soat2 UTSW 15 102153138 splice site probably null
R3421:Soat2 UTSW 15 102156809 splice site probably benign
R3422:Soat2 UTSW 15 102156809 splice site probably benign
R3754:Soat2 UTSW 15 102157078 missense probably damaging 1.00
R4062:Soat2 UTSW 15 102161091 missense possibly damaging 0.85
R4623:Soat2 UTSW 15 102157709 intron probably benign
R5004:Soat2 UTSW 15 102161111 missense probably damaging 1.00
R5808:Soat2 UTSW 15 102154025 splice site probably null
R6481:Soat2 UTSW 15 102162055 missense probably damaging 1.00
R6595:Soat2 UTSW 15 102160593 missense probably damaging 0.98
R6876:Soat2 UTSW 15 102160614 missense probably damaging 1.00
R7345:Soat2 UTSW 15 102162578 missense probably benign 0.13
R7429:Soat2 UTSW 15 102154300 missense probably damaging 1.00
R7572:Soat2 UTSW 15 102154021 critical splice donor site probably null
R7653:Soat2 UTSW 15 102162578 missense probably damaging 1.00
R7867:Soat2 UTSW 15 102151163 critical splice donor site probably null
R7910:Soat2 UTSW 15 102160671 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATTGCCATGATCCAGCGTCTC -3'
(R):5'- GATGATTTCCCTGACAAGCCTCCC -3'

Sequencing Primer
(F):5'- CCCAGCATCAGGTGGAACTATG -3'
(R):5'- CCTCAGGGTTGGACACAG -3'
Posted On2013-04-24