Incidental Mutation 'R4212:Lats2'
ID319270
Institutional Source Beutler Lab
Gene Symbol Lats2
Ensembl Gene ENSMUSG00000021959
Gene Namelarge tumor suppressor 2
Synonyms
MMRRC Submission 041641-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4212 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location57689662-57758388 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 57696255 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 802 (D802N)
Ref Sequence ENSEMBL: ENSMUSP00000022531 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022531] [ENSMUST00000173964] [ENSMUST00000173990] [ENSMUST00000174213] [ENSMUST00000174694]
PDB Structure Solution structure of RSGI RUH-038, a UBA domain from Mouse LATS2 (Large Tumor Suppressor homolog 2) [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022531
AA Change: D802N

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022531
Gene: ENSMUSG00000021959
AA Change: D802N

DomainStartEndE-ValueType
PDB:2COS|A 91 138 3e-20 PDB
low complexity region 210 223 N/A INTRINSIC
low complexity region 401 408 N/A INTRINSIC
low complexity region 437 444 N/A INTRINSIC
low complexity region 471 482 N/A INTRINSIC
low complexity region 517 529 N/A INTRINSIC
S_TKc 626 931 2.94e-94 SMART
S_TK_X 932 1002 1.21e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172474
Predicted Effect probably benign
Transcript: ENSMUST00000173964
SMART Domains Protein: ENSMUSP00000134142
Gene: ENSMUSG00000021959

DomainStartEndE-ValueType
low complexity region 21 28 N/A INTRINSIC
low complexity region 57 64 N/A INTRINSIC
low complexity region 91 102 N/A INTRINSIC
low complexity region 137 149 N/A INTRINSIC
Pfam:Pkinase 233 288 2.3e-5 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173990
AA Change: D802N

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133976
Gene: ENSMUSG00000021959
AA Change: D802N

DomainStartEndE-ValueType
PDB:2COS|A 91 138 8e-22 PDB
low complexity region 210 223 N/A INTRINSIC
low complexity region 401 408 N/A INTRINSIC
low complexity region 437 444 N/A INTRINSIC
low complexity region 471 482 N/A INTRINSIC
low complexity region 517 529 N/A INTRINSIC
S_TKc 626 893 7.75e-71 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174213
SMART Domains Protein: ENSMUSP00000134321
Gene: ENSMUSG00000021959

DomainStartEndE-ValueType
PDB:2COS|A 91 114 2e-6 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000174694
AA Change: D802N

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133680
Gene: ENSMUSG00000114942
AA Change: D802N

DomainStartEndE-ValueType
PDB:2COS|A 91 138 7e-22 PDB
low complexity region 210 223 N/A INTRINSIC
low complexity region 401 408 N/A INTRINSIC
low complexity region 437 444 N/A INTRINSIC
low complexity region 471 482 N/A INTRINSIC
low complexity region 517 529 N/A INTRINSIC
Pfam:Pkinase 626 792 2.2e-38 PFAM
Pfam:Pkinase_Tyr 626 795 2.8e-21 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase belonging to the LATS tumor suppressor family. The protein localizes to centrosomes during interphase, and early and late metaphase. It interacts with the centrosomal proteins aurora-A and ajuba and is required for accumulation of gamma-tubulin and spindle formation at the onset of mitosis. It also interacts with a negative regulator of p53 and may function in a positive feedback loop with p53 that responds to cytoskeleton damage. Additionally, it can function as a co-repressor of androgen-responsive gene expression. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality with decreased cell proliferation, chromosomal instability, atrial hyperplasia, ventricular hypoplasia, delayed embryonic development, an irregular kinked neural tube, and hemorrhages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik C T 13: 58,381,991 G269E probably damaging Het
A1bg G T 15: 60,919,736 L284M possibly damaging Het
Adamts15 A G 9: 30,906,174 V536A probably damaging Het
AI464131 T C 4: 41,498,307 E441G probably benign Het
Arsi A T 18: 60,916,701 I219F probably damaging Het
Atg7 G A 6: 114,703,425 G447E probably benign Het
Bdp1 T A 13: 100,059,585 H1223L probably benign Het
Cep152 A G 2: 125,620,001 M87T probably benign Het
Chrm3 T C 13: 9,877,755 D415G probably benign Het
Chrnb2 A T 3: 89,761,544 C155S probably damaging Het
Col6a4 T A 9: 106,075,370 Q443L probably benign Het
D5Ertd579e A T 5: 36,614,479 D857E probably damaging Het
Efcab6 T C 15: 83,892,863 D1124G probably damaging Het
F830045P16Rik C T 2: 129,460,353 A440T probably benign Het
Gc T C 5: 89,435,575 K370E probably benign Het
Gm11559 A G 11: 99,864,900 Q125R unknown Het
Gm3985 A T 8: 32,942,456 noncoding transcript Het
Gm648 C T X: 56,545,208 V78I probably benign Het
Gm8765 C T 13: 50,700,352 T82I possibly damaging Het
Gucy2e A G 11: 69,228,123 F681S probably damaging Het
Hip1r A G 5: 123,999,890 I760V probably benign Het
Islr2 C T 9: 58,199,320 G219D probably damaging Het
Itgae A G 11: 73,119,352 H556R probably benign Het
Jag1 T C 2: 137,085,070 D923G probably benign Het
Kmt2c A G 5: 25,347,359 probably null Het
Kmt2d A G 15: 98,845,003 probably benign Het
Krtap17-1 A G 11: 99,993,914 L9P unknown Het
Lrfn5 A T 12: 61,843,820 T632S probably benign Het
Myo9a C T 9: 59,906,066 R2183* probably null Het
Naip1 T C 13: 100,426,875 probably null Het
Nf1 T A 11: 79,469,798 V1434E probably damaging Het
Nlrc4 T C 17: 74,447,115 Y91C possibly damaging Het
Olfr1454 T G 19: 13,063,759 M116R probably damaging Het
Olfr173 T A 16: 58,797,369 H159L possibly damaging Het
Olfr723 A T 14: 49,928,889 Y218* probably null Het
Pard3 T A 8: 127,610,458 I1143K probably benign Het
Pcdha7 A G 18: 36,974,974 T351A probably benign Het
Phf2 C A 13: 48,820,613 G318V unknown Het
Plch1 T A 3: 63,870,759 probably benign Het
Polr1c A G 17: 46,246,120 I79T probably damaging Het
Ppp2r5e A G 12: 75,469,551 I244T probably damaging Het
Psmd12 T C 11: 107,485,759 C74R probably damaging Het
Ralgapa1 A G 12: 55,739,330 probably null Het
Robo3 C T 9: 37,421,898 G781D probably damaging Het
Scn8a T C 15: 100,957,073 V147A possibly damaging Het
Sema3b C T 9: 107,603,398 V117M probably damaging Het
Sfxn5 A T 6: 85,332,306 L139* probably null Het
Slc2a12 A T 10: 22,702,094 K596N probably benign Het
Sorcs1 G A 19: 50,225,175 R705C probably damaging Het
Tlr4 T A 4: 66,840,326 I452N probably damaging Het
Tshz3 A G 7: 36,770,119 D511G probably damaging Het
Usp44 A G 10: 93,846,770 K314E possibly damaging Het
Other mutations in Lats2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Lats2 APN 14 57691569 missense probably benign 0.09
IGL02104:Lats2 APN 14 57734012 missense probably damaging 1.00
IGL02173:Lats2 APN 14 57697260 missense probably damaging 1.00
IGL02377:Lats2 APN 14 57691595 missense probably damaging 1.00
IGL02995:Lats2 APN 14 57700348 missense probably damaging 1.00
R6846_Lats2_781 UTSW 14 57696134 missense probably damaging 1.00
PIT4472001:Lats2 UTSW 14 57699357 nonsense probably null
R0653:Lats2 UTSW 14 57700196 nonsense probably null
R0780:Lats2 UTSW 14 57691296 missense probably damaging 1.00
R1129:Lats2 UTSW 14 57700333 missense possibly damaging 0.71
R1851:Lats2 UTSW 14 57697455 missense probably damaging 1.00
R1882:Lats2 UTSW 14 57697354 missense probably damaging 1.00
R2184:Lats2 UTSW 14 57691559 missense probably damaging 0.99
R3498:Lats2 UTSW 14 57722466 missense possibly damaging 0.95
R3692:Lats2 UTSW 14 57691541 missense probably damaging 1.00
R4357:Lats2 UTSW 14 57699383 missense probably damaging 1.00
R4962:Lats2 UTSW 14 57699592 missense probably damaging 1.00
R5394:Lats2 UTSW 14 57691353 missense probably benign 0.10
R5477:Lats2 UTSW 14 57699553 missense probably benign 0.00
R5729:Lats2 UTSW 14 57722735 missense probably benign 0.04
R5802:Lats2 UTSW 14 57694418 missense probably damaging 0.99
R5931:Lats2 UTSW 14 57696131 missense probably damaging 1.00
R6016:Lats2 UTSW 14 57734175 missense probably damaging 1.00
R6376:Lats2 UTSW 14 57722509 missense probably benign 0.00
R6624:Lats2 UTSW 14 57694312 critical splice donor site probably null
R6638:Lats2 UTSW 14 57699365 missense probably damaging 1.00
R6846:Lats2 UTSW 14 57696134 missense probably damaging 1.00
R7198:Lats2 UTSW 14 57697125 missense probably damaging 1.00
R7233:Lats2 UTSW 14 57722694 splice site probably null
R7883:Lats2 UTSW 14 57697200 missense probably damaging 1.00
R8081:Lats2 UTSW 14 57700511 missense probably damaging 1.00
R8356:Lats2 UTSW 14 57697410 missense probably damaging 1.00
R8508:Lats2 UTSW 14 57722705 missense probably benign 0.08
R8536:Lats2 UTSW 14 57703038 missense probably damaging 1.00
R8767:Lats2 UTSW 14 57694324 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTACAACTGGGCAGTGAGC -3'
(R):5'- TGGAGTCGTTGCTCAGTAAAC -3'

Sequencing Primer
(F):5'- GCAGTGAGCCGAGGAGG -3'
(R):5'- CGTTGCTCAGTAAACGATACTTGACC -3'
Posted On2015-06-10