Mutagenetix > Incidental Mutation

Incidental Mutation 'R4212:Lats2'

319270

Institutional Source

Beutler Lab

Gene Symbol

Lats2

Ensembl Gene

ENSMUSG00000021959

Gene Name

large tumor suppressor 2

Synonyms

MMRRC Submission

041641-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4212 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

57689662-57758388 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 57696255 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 802 (D802N)

Ref Sequence

ENSEMBL: ENSMUSP00000022531 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022531] [ENSMUST00000173964] [ENSMUST00000173990] [ENSMUST00000174213] [ENSMUST00000174694]

AlphaFold

Q7TSJ6

PDB Structure

Solution structure of RSGI RUH-038, a UBA domain from Mouse LATS2 (Large Tumor Suppressor homolog 2) [SOLUTION NMR]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000022531
AA Change: D802N

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000022531
Gene: ENSMUSG00000021959
AA Change: D802N

Domain	Start	End	E-Value	Type
PDB:2COS\|A	91	138	3e-20	PDB
low complexity region	210	223	N/A	INTRINSIC
low complexity region	401	408	N/A	INTRINSIC
low complexity region	437	444	N/A	INTRINSIC
low complexity region	471	482	N/A	INTRINSIC
low complexity region	517	529	N/A	INTRINSIC
S_TKc	626	931	2.94e-94	SMART
S_TK_X	932	1002	1.21e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000082591

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172474

Predicted Effect

probably benign
Transcript: ENSMUST00000173964

SMART Domains

Protein: ENSMUSP00000134142
Gene: ENSMUSG00000021959

Domain	Start	End	E-Value	Type
low complexity region	21	28	N/A	INTRINSIC
low complexity region	57	64	N/A	INTRINSIC
low complexity region	91	102	N/A	INTRINSIC
low complexity region	137	149	N/A	INTRINSIC
Pfam:Pkinase	233	288	2.3e-5	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000173990
AA Change: D802N

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000133976
Gene: ENSMUSG00000021959
AA Change: D802N

Domain	Start	End	E-Value	Type
PDB:2COS\|A	91	138	8e-22	PDB
low complexity region	210	223	N/A	INTRINSIC
low complexity region	401	408	N/A	INTRINSIC
low complexity region	437	444	N/A	INTRINSIC
low complexity region	471	482	N/A	INTRINSIC
low complexity region	517	529	N/A	INTRINSIC
S_TKc	626	893	7.75e-71	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000174213

SMART Domains

Protein: ENSMUSP00000134321
Gene: ENSMUSG00000021959

Domain	Start	End	E-Value	Type
PDB:2COS\|A	91	114	2e-6	PDB

Predicted Effect

possibly damaging
Transcript: ENSMUST00000174694
AA Change: D802N

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000133680
Gene: ENSMUSG00000114942
AA Change: D802N

Domain	Start	End	E-Value	Type
PDB:2COS\|A	91	138	7e-22	PDB
low complexity region	210	223	N/A	INTRINSIC
low complexity region	401	408	N/A	INTRINSIC
low complexity region	437	444	N/A	INTRINSIC
low complexity region	471	482	N/A	INTRINSIC
low complexity region	517	529	N/A	INTRINSIC
Pfam:Pkinase	626	792	2.2e-38	PFAM
Pfam:Pkinase_Tyr	626	795	2.8e-21	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase belonging to the LATS tumor suppressor family. The protein localizes to centrosomes during interphase, and early and late metaphase. It interacts with the centrosomal proteins aurora-A and ajuba and is required for accumulation of gamma-tubulin and spindle formation at the onset of mitosis. It also interacts with a negative regulator of p53 and may function in a positive feedback loop with p53 that responds to cytoskeleton damage. Additionally, it can function as a co-repressor of androgen-responsive gene expression. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality with decreased cell proliferation, chromosomal instability, atrial hyperplasia, ventricular hypoplasia, delayed embryonic development, an irregular kinked neural tube, and hemorrhages. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210016F16Rik	C	T	13: 58,381,991	G269E	probably damaging	Het
A1bg	G	T	15: 60,919,736	L284M	possibly damaging	Het
Adamts15	A	G	9: 30,906,174	V536A	probably damaging	Het
AI464131	T	C	4: 41,498,307	E441G	probably benign	Het
Arsi	A	T	18: 60,916,701	I219F	probably damaging	Het
Atg7	G	A	6: 114,703,425	G447E	probably benign	Het
Bdp1	T	A	13: 100,059,585	H1223L	probably benign	Het
Cep152	A	G	2: 125,620,001	M87T	probably benign	Het
Chrm3	T	C	13: 9,877,755	D415G	probably benign	Het
Chrnb2	A	T	3: 89,761,544	C155S	probably damaging	Het
Col6a4	T	A	9: 106,075,370	Q443L	probably benign	Het
D5Ertd579e	A	T	5: 36,614,479	D857E	probably damaging	Het
Efcab6	T	C	15: 83,892,863	D1124G	probably damaging	Het
F830045P16Rik	C	T	2: 129,460,353	A440T	probably benign	Het
Gc	T	C	5: 89,435,575	K370E	probably benign	Het
Gm11559	A	G	11: 99,864,900	Q125R	unknown	Het
Gm3985	A	T	8: 32,942,456		noncoding transcript	Het
Gm648	C	T	X: 56,545,208	V78I	probably benign	Het
Gm8765	C	T	13: 50,700,352	T82I	possibly damaging	Het
Gucy2e	A	G	11: 69,228,123	F681S	probably damaging	Het
Hip1r	A	G	5: 123,999,890	I760V	probably benign	Het
Islr2	C	T	9: 58,199,320	G219D	probably damaging	Het
Itgae	A	G	11: 73,119,352	H556R	probably benign	Het
Jag1	T	C	2: 137,085,070	D923G	probably benign	Het
Kmt2c	A	G	5: 25,347,359		probably null	Het
Kmt2d	A	G	15: 98,845,003		probably benign	Het
Krtap17-1	A	G	11: 99,993,914	L9P	unknown	Het
Lrfn5	A	T	12: 61,843,820	T632S	probably benign	Het
Myo9a	C	T	9: 59,906,066	R2183*	probably null	Het
Naip1	T	C	13: 100,426,875		probably null	Het
Nf1	T	A	11: 79,469,798	V1434E	probably damaging	Het
Nlrc4	T	C	17: 74,447,115	Y91C	possibly damaging	Het
Olfr1454	T	G	19: 13,063,759	M116R	probably damaging	Het
Olfr173	T	A	16: 58,797,369	H159L	possibly damaging	Het
Olfr723	A	T	14: 49,928,889	Y218*	probably null	Het
Pard3	T	A	8: 127,610,458	I1143K	probably benign	Het
Pcdha7	A	G	18: 36,974,974	T351A	probably benign	Het
Phf2	C	A	13: 48,820,613	G318V	unknown	Het
Plch1	T	A	3: 63,870,759		probably benign	Het
Polr1c	A	G	17: 46,246,120	I79T	probably damaging	Het
Ppp2r5e	A	G	12: 75,469,551	I244T	probably damaging	Het
Psmd12	T	C	11: 107,485,759	C74R	probably damaging	Het
Ralgapa1	A	G	12: 55,739,330		probably null	Het
Robo3	C	T	9: 37,421,898	G781D	probably damaging	Het
Scn8a	T	C	15: 100,957,073	V147A	possibly damaging	Het
Sema3b	C	T	9: 107,603,398	V117M	probably damaging	Het
Sfxn5	A	T	6: 85,332,306	L139*	probably null	Het
Slc2a12	A	T	10: 22,702,094	K596N	probably benign	Het
Sorcs1	G	A	19: 50,225,175	R705C	probably damaging	Het
Tlr4	T	A	4: 66,840,326	I452N	probably damaging	Het
Tshz3	A	G	7: 36,770,119	D511G	probably damaging	Het
Usp44	A	G	10: 93,846,770	K314E	possibly damaging	Het

Other mutations in Lats2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00272:Lats2	APN	14	57691569	missense	probably benign	0.09
IGL02104:Lats2	APN	14	57734012	missense	probably damaging	1.00
IGL02173:Lats2	APN	14	57697260	missense	probably damaging	1.00
IGL02377:Lats2	APN	14	57691595	missense	probably damaging	1.00
IGL02995:Lats2	APN	14	57700348	missense	probably damaging	1.00
Morpheus	UTSW	14	57696134	missense	probably damaging	1.00
PIT4472001:Lats2	UTSW	14	57699357	nonsense	probably null
R0653:Lats2	UTSW	14	57700196	nonsense	probably null
R0780:Lats2	UTSW	14	57691296	missense	probably damaging	1.00
R1129:Lats2	UTSW	14	57700333	missense	possibly damaging	0.71
R1851:Lats2	UTSW	14	57697455	missense	probably damaging	1.00
R1882:Lats2	UTSW	14	57697354	missense	probably damaging	1.00
R2184:Lats2	UTSW	14	57691559	missense	probably damaging	0.99
R3498:Lats2	UTSW	14	57722466	missense	possibly damaging	0.95
R3692:Lats2	UTSW	14	57691541	missense	probably damaging	1.00
R4357:Lats2	UTSW	14	57699383	missense	probably damaging	1.00
R4962:Lats2	UTSW	14	57699592	missense	probably damaging	1.00
R5394:Lats2	UTSW	14	57691353	missense	probably benign	0.10
R5477:Lats2	UTSW	14	57699553	missense	probably benign	0.00
R5729:Lats2	UTSW	14	57722735	missense	probably benign	0.04
R5802:Lats2	UTSW	14	57694418	missense	probably damaging	0.99
R5931:Lats2	UTSW	14	57696131	missense	probably damaging	1.00
R6016:Lats2	UTSW	14	57734175	missense	probably damaging	1.00
R6376:Lats2	UTSW	14	57722509	missense	probably benign	0.00
R6624:Lats2	UTSW	14	57694312	critical splice donor site	probably null
R6638:Lats2	UTSW	14	57699365	missense	probably damaging	1.00
R6846:Lats2	UTSW	14	57696134	missense	probably damaging	1.00
R7198:Lats2	UTSW	14	57697125	missense	probably damaging	1.00
R7233:Lats2	UTSW	14	57722694	splice site	probably null
R7883:Lats2	UTSW	14	57697200	missense	probably damaging	1.00
R8081:Lats2	UTSW	14	57700511	missense	probably damaging	1.00
R8356:Lats2	UTSW	14	57697410	missense	probably damaging	1.00
R8508:Lats2	UTSW	14	57722705	missense	probably benign	0.08
R8536:Lats2	UTSW	14	57703038	missense	probably damaging	1.00
R8767:Lats2	UTSW	14	57694324	missense	probably damaging	1.00
R9579:Lats2	UTSW	14	57699734	missense	probably damaging	1.00
R9643:Lats2	UTSW	14	57699418	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- CTTACAACTGGGCAGTGAGC -3'
(R):5'- TGGAGTCGTTGCTCAGTAAAC -3'

Sequencing Primer
(F):5'- GCAGTGAGCCGAGGAGG -3'
(R):5'- CGTTGCTCAGTAAACGATACTTGACC -3'

Posted On

2015-06-10