Incidental Mutation 'R4182:Zfp560'
List |< first << previous [record 37 of 38] next >> last >|
ID319781
Institutional Source Beutler Lab
Gene Symbol Zfp560
Ensembl Gene ENSMUSG00000045519
Gene Namezinc finger protein 560
Synonyms
MMRRC Submission 041018-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4182 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location20345136-20385177 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20347448 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 706 (I706T)
Ref Sequence ENSEMBL: ENSMUSP00000065620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068079]
Predicted Effect probably benign
Transcript: ENSMUST00000068079
AA Change: I706T

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000065620
Gene: ENSMUSG00000045519
AA Change: I706T

DomainStartEndE-ValueType
KRAB 41 101 3.22e-27 SMART
low complexity region 147 158 N/A INTRINSIC
ZnF_C2H2 279 301 4.01e-5 SMART
ZnF_C2H2 307 329 9.58e-3 SMART
ZnF_C2H2 335 357 5.5e-3 SMART
ZnF_C2H2 363 385 9.58e-3 SMART
ZnF_C2H2 391 413 3.74e-5 SMART
ZnF_C2H2 419 441 2.43e-4 SMART
ZnF_C2H2 447 469 1.28e-3 SMART
ZnF_C2H2 475 497 1.06e-4 SMART
ZnF_C2H2 503 525 3.11e-2 SMART
ZnF_C2H2 531 553 8.47e-4 SMART
ZnF_C2H2 559 581 2.99e-4 SMART
ZnF_C2H2 587 609 4.24e-4 SMART
ZnF_C2H2 615 637 3.44e-4 SMART
ZnF_C2H2 643 665 1.26e-2 SMART
ZnF_C2H2 671 693 1.69e-3 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap12 T C 18: 6,111,734 D210G probably damaging Het
Baz2b A T 2: 60,098,457 probably benign Het
Bcl9 A G 3: 97,213,683 probably null Het
Cfap20 A T 8: 95,424,656 I19N probably damaging Het
Clnk T A 5: 38,747,850 probably benign Het
Col18a1 C T 10: 77,058,841 probably null Het
Cux2 C T 5: 121,868,492 G905D probably damaging Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Ddx59 T A 1: 136,439,861 S569T probably benign Het
Des C G 1: 75,362,584 A251G probably benign Het
Dnajc21 T C 15: 10,459,933 probably null Het
Fam217a T C 13: 34,910,256 T416A possibly damaging Het
Gbp9 T A 5: 105,083,595 Q375L probably benign Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
H2-T24 A T 17: 36,015,484 N174K possibly damaging Het
Heatr3 T C 8: 88,171,002 probably benign Het
Lurap1l G A 4: 80,953,858 S196N probably benign Het
Naaa C T 5: 92,272,554 probably null Het
Nbea A G 3: 56,008,427 C875R probably damaging Het
Nme1 G A 11: 93,960,804 T87I probably benign Het
Nphp3 T C 9: 104,038,464 S124P probably benign Het
Nrap C T 19: 56,350,327 V907M probably damaging Het
Olfr1312 G T 2: 112,042,528 P168Q probably damaging Het
Olfr97 T G 17: 37,231,848 H174P possibly damaging Het
Pcdhga8 A G 18: 37,727,283 N464S probably damaging Het
Pdcd6ip T C 9: 113,700,010 I75V probably benign Het
Ralgapa2 G A 2: 146,435,994 P416S probably damaging Het
Saal1 A G 7: 46,710,652 probably benign Het
Susd5 A G 9: 114,095,985 E312G probably benign Het
Tgfb2 T A 1: 186,629,025 D315V possibly damaging Het
Tll1 C T 8: 64,041,511 D737N probably damaging Het
Tmem115 A G 9: 107,535,283 T269A probably damaging Het
Ttc39b T C 4: 83,237,301 D490G probably damaging Het
Vmn1r72 C T 7: 11,670,068 R151K probably benign Het
Vmn2r74 A T 7: 85,957,187 F317Y possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Other mutations in Zfp560
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Zfp560 APN 9 20348808 missense probably benign 0.00
IGL02400:Zfp560 APN 9 20350600 missense possibly damaging 0.73
R0002:Zfp560 UTSW 9 20347517 missense probably damaging 1.00
R0004:Zfp560 UTSW 9 20347967 missense probably damaging 1.00
R0019:Zfp560 UTSW 9 20348360 missense probably benign 0.23
R1401:Zfp560 UTSW 9 20351853 missense possibly damaging 0.71
R1481:Zfp560 UTSW 9 20348790 missense probably benign
R1521:Zfp560 UTSW 9 20348775 splice site probably null
R1569:Zfp560 UTSW 9 20348715 missense possibly damaging 0.83
R1579:Zfp560 UTSW 9 20347991 missense possibly damaging 0.73
R1673:Zfp560 UTSW 9 20347653 missense probably benign 0.37
R1694:Zfp560 UTSW 9 20347986 nonsense probably null
R1796:Zfp560 UTSW 9 20351930 missense possibly damaging 0.71
R2971:Zfp560 UTSW 9 20348944 missense probably benign 0.00
R3416:Zfp560 UTSW 9 20347678 nonsense probably null
R4509:Zfp560 UTSW 9 20348723 missense probably damaging 1.00
R4708:Zfp560 UTSW 9 20351918 missense possibly damaging 0.85
R4735:Zfp560 UTSW 9 20349051 missense probably benign 0.01
R4937:Zfp560 UTSW 9 20347967 missense probably damaging 1.00
R5562:Zfp560 UTSW 9 20350587 nonsense probably null
R6597:Zfp560 UTSW 9 20348001 missense probably benign 0.00
R6852:Zfp560 UTSW 9 20348043 missense probably damaging 0.99
R6863:Zfp560 UTSW 9 20348499 missense probably damaging 0.99
R7267:Zfp560 UTSW 9 20348088 missense probably damaging 0.96
R7619:Zfp560 UTSW 9 20348910 missense probably benign 0.01
R7763:Zfp560 UTSW 9 20347323 missense possibly damaging 0.96
R8220:Zfp560 UTSW 9 20349052 missense probably benign 0.00
Z1176:Zfp560 UTSW 9 20347704 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGTGAGTAGAGATGTCGAGTCC -3'
(R):5'- CACACTGGAGAGAAGCCCTTT -3'

Sequencing Primer
(F):5'- CAAGCCTACATGGTTGTTGCCAG -3'
(R):5'- GAGAAGCCCTTTGAGTGTAATG -3'
Posted On2015-06-10