Mutagenetix > Incidental Mutation

Incidental Mutation 'R4244:Map3k6'

320336

Institutional Source

Beutler Lab

Gene Symbol

Map3k6

Ensembl Gene

ENSMUSG00000028862

Gene Name

mitogen-activated protein kinase kinase kinase 6

Synonyms

Ask2, MAPKKK6, MEKK6

MMRRC Submission

041060-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.312) question?

Stock #

R4244 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

133240818-133252929 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 133251947 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 1204 (Y1204H)

Ref Sequence

ENSEMBL: ENSMUSP00000030677 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030674] [ENSMUST00000030677] [ENSMUST00000105908]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000030674

SMART Domains

Protein: ENSMUSP00000030674
Gene: ENSMUSG00000028860

Domain	Start	End	E-Value	Type
PDB:3BC1\|F	40	92	2e-9	PDB
low complexity region	169	183	N/A	INTRINSIC
low complexity region	235	262	N/A	INTRINSIC
C2	288	389	2.36e-17	SMART
C2	429	532	6.96e-6	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000030677
AA Change: Y1204H

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000030677
Gene: ENSMUSG00000028862
AA Change: Y1204H

Domain	Start	End	E-Value	Type
low complexity region	98	109	N/A	INTRINSIC
Pfam:DUF4071	130	508	2.3e-150	PFAM
S_TKc	649	907	3.49e-87	SMART
low complexity region	925	940	N/A	INTRINSIC
low complexity region	947	960	N/A	INTRINSIC
low complexity region	975	990	N/A	INTRINSIC
low complexity region	1130	1146	N/A	INTRINSIC
coiled coil region	1164	1195	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000105908

SMART Domains

Protein: ENSMUSP00000101528
Gene: ENSMUSG00000028860

Domain	Start	End	E-Value	Type
PDB:3BC1\|F	40	92	2e-9	PDB
low complexity region	157	171	N/A	INTRINSIC
low complexity region	223	250	N/A	INTRINSIC
C2	276	359	3.15e-4	SMART
C2	364	467	6.96e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123612

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127681

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134895

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142039

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154911

Meta Mutation Damage Score

0.0817

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

98% (47/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase that forms a component of protein kinase-mediated signal transduction cascades. The encoded kinase participates in the regulation of vascular endothelial growth factor (VEGF) expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous and heterozygous null mice display an increased incidence of chemically induced skin tumors and homozygous mice also show resistance to induced apoptosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930452B06Rik	T	C	14: 8,482,521	T551A	probably benign	Het
Actr1b	T	C	1: 36,701,830	Y171C	possibly damaging	Het
Ap1g1	G	A	8: 109,833,490	S281N	probably benign	Het
Arfgef3	C	A	10: 18,630,420	G878V	probably damaging	Het
Ccdc137	T	C	11: 120,462,018	F196S	probably damaging	Het
Ccdc18	C	T	5: 108,148,972	Q214*	probably null	Het
Ccrl2	T	C	9: 111,055,354	I359V	probably benign	Het
Cdh20	C	T	1: 104,942,143	T196I	probably damaging	Het
Col6a3	G	T	1: 90,786,639	T1683K	unknown	Het
Copa	A	G	1: 172,110,718	I524V	probably benign	Het
Cyld	A	T	8: 88,730,755	R536*	probably null	Het
Dock10	T	A	1: 80,566,755	E905V	probably benign	Het
Dock5	A	G	14: 67,774,582	F1348L	probably benign	Het
Efcab3	A	T	11: 105,111,803	K5664I	probably damaging	Het
Gm5174	C	A	10: 86,656,280		noncoding transcript	Het
Gm9892	A	T	8: 52,196,400		noncoding transcript	Het
Grm4	A	G	17: 27,502,735	I144T	probably damaging	Het
Kcnv1	G	A	15: 45,114,444	T66M	probably damaging	Het
Krt28	G	T	11: 99,374,550	S97Y	probably damaging	Het
Mfsd2b	G	T	12: 4,874,356		probably benign	Het
Nav3	T	C	10: 109,769,296	D972G	probably damaging	Het
Olfr1167	T	C	2: 88,149,288	T244A	probably benign	Het
Olfr131	C	T	17: 38,082,430	V183I	probably benign	Het
Olfr319	T	G	11: 58,702,451	L250R	probably damaging	Het
Prex1	G	A	2: 166,570,336	R392W	probably damaging	Het
Ptpn5	C	T	7: 47,091,548	W38*	probably null	Het
Rab3gap1	T	C	1: 127,937,567		probably null	Het
Rfx7	A	G	9: 72,591,769	T72A	possibly damaging	Het
Scn7a	T	C	2: 66,742,001	I209V	probably benign	Het
Sh3d21	C	T	4: 126,150,718		probably benign	Het
Slc27a1	A	G	8: 71,584,973	T535A	probably benign	Het
Slc5a5	A	G	8: 70,890,286	V210A	probably benign	Het
Snx25	A	G	8: 46,105,254	C239R	probably damaging	Het
Sp5	T	C	2: 70,477,038	F356L	probably damaging	Het
Spaca9	T	C	2: 28,692,986	I141V	probably benign	Het
Tbcd	T	A	11: 121,594,281	L763H	probably damaging	Het
Thnsl1	A	G	2: 21,212,248	E271G	probably benign	Het
Vmn1r79	T	A	7: 12,177,044	C284*	probably null	Het
Vwa5a	T	C	9: 38,737,816		probably benign	Het
Zar1	T	C	5: 72,580,393	E121G	possibly damaging	Het
Zscan29	C	T	2: 121,164,794		probably null	Het

Other mutations in Map3k6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00922:Map3k6	APN	4	133243044	splice site	probably benign
IGL01060:Map3k6	APN	4	133247302	splice site	probably null
IGL01116:Map3k6	APN	4	133247128	missense	probably damaging	0.98
IGL01341:Map3k6	APN	4	133248060	missense	possibly damaging	0.67
IGL02383:Map3k6	APN	4	133246621	splice site	probably null
IGL03090:Map3k6	APN	4	133243366	missense	probably benign	0.05
IGL03096:Map3k6	APN	4	133251345	nonsense	probably null
IGL03149:Map3k6	APN	4	133249688	missense	probably damaging	1.00
R0110:Map3k6	UTSW	4	133243794	missense	probably damaging	1.00
R0142:Map3k6	UTSW	4	133250946	missense	probably benign
R0189:Map3k6	UTSW	4	133246941	missense	possibly damaging	0.46
R0368:Map3k6	UTSW	4	133252659	missense	probably benign	0.23
R0417:Map3k6	UTSW	4	133248082	nonsense	probably null
R0595:Map3k6	UTSW	4	133241263	missense	probably damaging	0.98
R0597:Map3k6	UTSW	4	133245552	missense	possibly damaging	0.46
R0699:Map3k6	UTSW	4	133248126	missense	probably damaging	1.00
R1099:Map3k6	UTSW	4	133247128	missense	probably damaging	1.00
R1113:Map3k6	UTSW	4	133245815	missense	probably damaging	1.00
R1308:Map3k6	UTSW	4	133245815	missense	probably damaging	1.00
R1607:Map3k6	UTSW	4	133252473	missense	probably damaging	1.00
R2217:Map3k6	UTSW	4	133246672	missense	possibly damaging	0.46
R3734:Map3k6	UTSW	4	133248396	missense	possibly damaging	0.79
R3735:Map3k6	UTSW	4	133246372	missense	probably benign	0.21
R3743:Map3k6	UTSW	4	133245073	missense	probably benign	0.26
R4245:Map3k6	UTSW	4	133251947	missense	possibly damaging	0.65
R4465:Map3k6	UTSW	4	133246333	missense	possibly damaging	0.66
R4482:Map3k6	UTSW	4	133243399	missense	probably benign	0.00
R4827:Map3k6	UTSW	4	133248849	missense	possibly damaging	0.92
R5092:Map3k6	UTSW	4	133251743	missense	probably benign	0.00
R5110:Map3k6	UTSW	4	133247548	intron	probably benign
R5258:Map3k6	UTSW	4	133247642	missense	possibly damaging	0.81
R5369:Map3k6	UTSW	4	133247681	missense	probably damaging	0.99
R5642:Map3k6	UTSW	4	133245544	missense	probably damaging	0.99
R5648:Map3k6	UTSW	4	133243335	missense	probably benign	0.25
R6102:Map3k6	UTSW	4	133247131	critical splice donor site	probably null
R6144:Map3k6	UTSW	4	133245675	missense	probably damaging	1.00
R6476:Map3k6	UTSW	4	133250086	missense	probably damaging	0.98
R6511:Map3k6	UTSW	4	133248078	missense	probably damaging	0.98
R6522:Map3k6	UTSW	4	133250024	missense	possibly damaging	0.65
R6706:Map3k6	UTSW	4	133250939	nonsense	probably null
R6874:Map3k6	UTSW	4	133250656	missense	probably benign	0.02
R7069:Map3k6	UTSW	4	133251712	missense	probably benign	0.01
R7216:Map3k6	UTSW	4	133246900	missense	probably damaging	0.99
R7417:Map3k6	UTSW	4	133248396	missense	probably benign	0.43
R7538:Map3k6	UTSW	4	133251927	missense	probably benign
R7569:Map3k6	UTSW	4	133250077	missense	probably benign	0.04
R8003:Map3k6	UTSW	4	133248882	missense	probably benign	0.05
R8407:Map3k6	UTSW	4	133247593	missense	possibly damaging	0.95
R8817:Map3k6	UTSW	4	133246760	missense	probably benign	0.00
R8939:Map3k6	UTSW	4	133252643	unclassified	probably benign
R9285:Map3k6	UTSW	4	133245559	missense	probably damaging	1.00
R9308:Map3k6	UTSW	4	133243411	missense	probably damaging	1.00
R9400:Map3k6	UTSW	4	133241156	missense	probably damaging	1.00
R9401:Map3k6	UTSW	4	133241156	missense	probably damaging	1.00
R9573:Map3k6	UTSW	4	133252463	missense	probably damaging	0.99
R9677:Map3k6	UTSW	4	133241116	missense	probably benign	0.04
R9682:Map3k6	UTSW	4	133248108	missense	possibly damaging	0.61
R9745:Map3k6	UTSW	4	133252472	missense	probably damaging	1.00
R9751:Map3k6	UTSW	4	133251857	critical splice acceptor site	probably null
Z1088:Map3k6	UTSW	4	133245066	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGCCTTTTGGAATCACCCGG -3'
(R):5'- CATCTTTGCAGCAATGACAAAG -3'

Sequencing Primer
(F):5'- GCCTTTTGGAATCACCCGGATAAG -3'
(R):5'- ACTCACTCACCGTTTGGATAGTGG -3'

Posted On

2015-06-12