Incidental Mutation 'R8003:Map3k6'
ID616447
Institutional Source Beutler Lab
Gene Symbol Map3k6
Ensembl Gene ENSMUSG00000028862
Gene Namemitogen-activated protein kinase kinase kinase 6
SynonymsAsk2, MAPKKK6, MEKK6
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.373) question?
Stock #R8003 (G1)
Quality Score196.009
Status Validated
Chromosome4
Chromosomal Location133240818-133252929 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 133248882 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 805 (T805A)
Ref Sequence ENSEMBL: ENSMUSP00000030677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030674] [ENSMUST00000030677] [ENSMUST00000105908]
Predicted Effect probably benign
Transcript: ENSMUST00000030674
SMART Domains Protein: ENSMUSP00000030674
Gene: ENSMUSG00000028860

DomainStartEndE-ValueType
PDB:3BC1|F 40 92 2e-9 PDB
low complexity region 169 183 N/A INTRINSIC
low complexity region 235 262 N/A INTRINSIC
C2 288 389 2.36e-17 SMART
C2 429 532 6.96e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000030677
AA Change: T805A

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000030677
Gene: ENSMUSG00000028862
AA Change: T805A

DomainStartEndE-ValueType
low complexity region 98 109 N/A INTRINSIC
Pfam:DUF4071 130 508 2.3e-150 PFAM
S_TKc 649 907 3.49e-87 SMART
low complexity region 925 940 N/A INTRINSIC
low complexity region 947 960 N/A INTRINSIC
low complexity region 975 990 N/A INTRINSIC
low complexity region 1130 1146 N/A INTRINSIC
coiled coil region 1164 1195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105908
SMART Domains Protein: ENSMUSP00000101528
Gene: ENSMUSG00000028860

DomainStartEndE-ValueType
PDB:3BC1|F 40 92 2e-9 PDB
low complexity region 157 171 N/A INTRINSIC
low complexity region 223 250 N/A INTRINSIC
C2 276 359 3.15e-4 SMART
C2 364 467 6.96e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase that forms a component of protein kinase-mediated signal transduction cascades. The encoded kinase participates in the regulation of vascular endothelial growth factor (VEGF) expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous and heterozygous null mice display an increased incidence of chemically induced skin tumors and homozygous mice also show resistance to induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 A G 14: 55,781,635 V155A probably benign Het
Arfgef2 A G 2: 166,853,288 Y527C probably damaging Het
B020004J07Rik T C 4: 101,835,933 K290R probably benign Het
Brca1 C T 11: 101,524,477 G944R probably benign Het
C2cd2 A G 16: 97,886,086 probably null Het
Cass4 T C 2: 172,427,959 F654L unknown Het
Ccdc178 A T 18: 21,844,887 probably null Het
Cct4 T C 11: 22,996,040 probably null Het
Cish T C 9: 107,297,028 V5A possibly damaging Het
Col5a1 G A 2: 27,958,328 probably benign Het
Col6a3 G T 1: 90,775,733 N3037K unknown Het
Csmd2 T A 4: 128,539,187 C3012* probably null Het
Dclk2 T C 3: 86,793,301 probably null Het
Dhx38 A T 8: 109,556,140 D631E probably damaging Het
Eif2ak2 C A 17: 78,876,223 A66S probably damaging Het
Ephx2 A G 14: 66,124,333 probably null Het
Fbxw10 T G 11: 62,857,761 C405G possibly damaging Het
Galnt13 G T 2: 55,060,485 G393* probably null Het
Gm5591 G T 7: 38,519,759 H563Q probably damaging Het
Gtf3c5 A G 2: 28,569,361 I394T probably benign Het
Hectd4 G A 5: 121,339,518 A2835T possibly damaging Het
Herc2 A G 7: 56,168,904 D2781G possibly damaging Het
Kmt2b G T 7: 30,569,377 H2642Q probably damaging Het
Lars A T 18: 42,221,619 D754E probably damaging Het
Lrpprc A C 17: 84,752,317 S690A probably benign Het
Mthfd1l T G 10: 3,984,147 S160A probably benign Het
Mtmr6 G A 14: 60,282,095 probably null Het
Mybpc2 A T 7: 44,509,064 M698K probably damaging Het
Myh8 T A 11: 67,299,760 L1304M probably damaging Het
Mylip T A 13: 45,404,471 V117E probably benign Het
Npc1l1 T C 11: 6,215,129 Q1061R probably benign Het
Olfr1148 A G 2: 87,833,737 R233G probably benign Het
Olfr1164 A T 2: 88,093,245 Y230* probably null Het
Pkd2l2 G A 18: 34,428,179 M413I probably damaging Het
Plch2 C T 4: 155,054,523 G19D unknown Het
Psg22 A C 7: 18,724,425 Y347S probably damaging Het
Ptpre C A 7: 135,669,036 Q314K probably damaging Het
Rgs6 T C 12: 82,985,370 S54P probably damaging Het
Sbds C A 5: 130,250,885 V130F possibly damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc24a2 A T 4: 87,176,315 D322E probably benign Het
Slc45a4 G T 15: 73,585,313 Y585* probably null Het
Slc7a4 A C 16: 17,574,451 V373G possibly damaging Het
Sulf1 G A 1: 12,838,601 V613M probably damaging Het
Syt1 T C 10: 108,636,573 D150G probably damaging Het
Tnpo3 C A 6: 29,551,901 V888F probably benign Het
Trim9 T C 12: 70,346,834 H112R probably benign Het
Vmn2r80 T C 10: 79,148,877 I21T probably benign Het
Wdr41 C A 13: 95,013,146 A286E possibly damaging Het
Wnt8b T A 19: 44,511,957 C328S probably damaging Het
Ybx3 A T 6: 131,368,437 Y324* probably null Het
Zmynd15 T A 11: 70,460,941 H124Q probably benign Het
Other mutations in Map3k6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Map3k6 APN 4 133243044 splice site probably benign
IGL01060:Map3k6 APN 4 133247302 splice site probably null
IGL01116:Map3k6 APN 4 133247128 missense probably damaging 0.98
IGL01341:Map3k6 APN 4 133248060 missense possibly damaging 0.67
IGL02383:Map3k6 APN 4 133246621 splice site probably null
IGL03090:Map3k6 APN 4 133243366 missense probably benign 0.05
IGL03096:Map3k6 APN 4 133251345 nonsense probably null
IGL03149:Map3k6 APN 4 133249688 missense probably damaging 1.00
R0110:Map3k6 UTSW 4 133243794 missense probably damaging 1.00
R0142:Map3k6 UTSW 4 133250946 missense probably benign
R0189:Map3k6 UTSW 4 133246941 missense possibly damaging 0.46
R0368:Map3k6 UTSW 4 133252659 missense probably benign 0.23
R0417:Map3k6 UTSW 4 133248082 nonsense probably null
R0595:Map3k6 UTSW 4 133241263 missense probably damaging 0.98
R0597:Map3k6 UTSW 4 133245552 missense possibly damaging 0.46
R0699:Map3k6 UTSW 4 133248126 missense probably damaging 1.00
R1099:Map3k6 UTSW 4 133247128 missense probably damaging 1.00
R1113:Map3k6 UTSW 4 133245815 missense probably damaging 1.00
R1308:Map3k6 UTSW 4 133245815 missense probably damaging 1.00
R1607:Map3k6 UTSW 4 133252473 missense probably damaging 1.00
R2217:Map3k6 UTSW 4 133246672 missense possibly damaging 0.46
R3734:Map3k6 UTSW 4 133248396 missense possibly damaging 0.79
R3735:Map3k6 UTSW 4 133246372 missense probably benign 0.21
R3743:Map3k6 UTSW 4 133245073 missense probably benign 0.26
R4244:Map3k6 UTSW 4 133251947 missense possibly damaging 0.65
R4245:Map3k6 UTSW 4 133251947 missense possibly damaging 0.65
R4465:Map3k6 UTSW 4 133246333 missense possibly damaging 0.66
R4482:Map3k6 UTSW 4 133243399 missense probably benign 0.00
R4827:Map3k6 UTSW 4 133248849 missense possibly damaging 0.92
R5092:Map3k6 UTSW 4 133251743 missense probably benign 0.00
R5110:Map3k6 UTSW 4 133247548 intron probably benign
R5258:Map3k6 UTSW 4 133247642 missense possibly damaging 0.81
R5369:Map3k6 UTSW 4 133247681 missense probably damaging 0.99
R5642:Map3k6 UTSW 4 133245544 missense probably damaging 0.99
R5648:Map3k6 UTSW 4 133243335 missense probably benign 0.25
R6102:Map3k6 UTSW 4 133247131 critical splice donor site probably null
R6144:Map3k6 UTSW 4 133245675 missense probably damaging 1.00
R6476:Map3k6 UTSW 4 133250086 missense probably damaging 0.98
R6511:Map3k6 UTSW 4 133248078 missense probably damaging 0.98
R6522:Map3k6 UTSW 4 133250024 missense possibly damaging 0.65
R6706:Map3k6 UTSW 4 133250939 nonsense probably null
R6874:Map3k6 UTSW 4 133250656 missense probably benign 0.02
R7069:Map3k6 UTSW 4 133251712 missense probably benign 0.01
R7216:Map3k6 UTSW 4 133246900 missense probably damaging 0.99
R7417:Map3k6 UTSW 4 133248396 missense probably benign 0.43
R7538:Map3k6 UTSW 4 133251927 missense probably benign
R7569:Map3k6 UTSW 4 133250077 missense probably benign 0.04
Z1088:Map3k6 UTSW 4 133245066 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACACTCATAGAGGCTCAGGATG -3'
(R):5'- ACCTGTCTCCAGCCAGATTC -3'

Sequencing Primer
(F):5'- CTCATAGAGGCTCAGGATGTAATATC -3'
(R):5'- GGGTAAGAACACTGACTGCTCTTC -3'
Posted On2020-01-23