Incidental Mutation 'R4168:Elk3'
ID320664
Institutional Source Beutler Lab
Gene Symbol Elk3
Ensembl Gene ENSMUSG00000008398
Gene NameELK3, member of ETS oncogene family
SynonymsNet, D430049E23Rik, Erp, Sap-2
MMRRC Submission 041009-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.437) question?
Stock #R4168 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location93247414-93311135 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 93265335 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008542] [ENSMUST00000129827] [ENSMUST00000151153] [ENSMUST00000215286] [ENSMUST00000223340]
Predicted Effect probably damaging
Transcript: ENSMUST00000008542
AA Change: F185L

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000008542
Gene: ENSMUSG00000008398
AA Change: F185L

DomainStartEndE-ValueType
ETS 4 89 1.56e-55 SMART
low complexity region 200 222 N/A INTRINSIC
low complexity region 229 256 N/A INTRINSIC
low complexity region 278 299 N/A INTRINSIC
low complexity region 356 367 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129827
SMART Domains Protein: ENSMUSP00000122324
Gene: ENSMUSG00000008398

DomainStartEndE-ValueType
ETS 4 89 1.56e-55 SMART
low complexity region 200 217 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151153
SMART Domains Protein: ENSMUSP00000121754
Gene: ENSMUSG00000008398

DomainStartEndE-ValueType
ETS 4 80 7.6e-36 SMART
low complexity region 89 100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215286
Predicted Effect probably benign
Transcript: ENSMUST00000216729
Predicted Effect probably null
Transcript: ENSMUST00000223340
Meta Mutation Damage Score 0.2380 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ETS-domain transcription factor family and the ternary complex factor (TCF) subfamily. Proteins in this subfamily regulate transcription when recruited by serum response factor to bind to serum response elements. This protein is activated by signal-induced phosphorylation; studies in rodents suggest that it is a transcriptional inhibitor in the absence of Ras, but activates transcription when Ras is present. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygotes for a null allele develop a vascular defect associated with lymphangiectasis and die prematurely due to respiratory failure resulting from chylothorax. Homozygotes for a different null allele show a transient delay in retinal primary plexus vascularization and tortuous retinal arteries. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,137,109 L151P probably benign Het
C3 A T 17: 57,218,608 F883I probably benign Het
Cbr4 T A 8: 61,491,521 probably benign Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Chpf2 T C 5: 24,591,790 V578A possibly damaging Het
Clasrp A G 7: 19,581,154 probably benign Het
Cmip A T 8: 117,456,917 N743I probably damaging Het
Ctif A C 18: 75,637,215 L33R probably damaging Het
Dmap1 T A 4: 117,681,310 H54L possibly damaging Het
Flt4 G A 11: 49,630,573 R440H probably benign Het
Gabrb2 A T 11: 42,421,328 probably benign Het
Gm12789 A G 4: 101,989,962 Y148C possibly damaging Het
Gm5724 T C 6: 141,738,947 I261V probably benign Het
Haspin A G 11: 73,136,022 L747P probably damaging Het
Intu C T 3: 40,672,623 P278L probably benign Het
Kif27 A G 13: 58,345,748 I127T probably benign Het
Mogat1 T C 1: 78,512,035 V25A possibly damaging Het
Nop14 A G 5: 34,656,744 S157P probably damaging Het
Olfr1040 A G 2: 86,146,179 I185T probably benign Het
Olfr1167 T C 2: 88,149,845 H58R probably damaging Het
Olfr195 A T 16: 59,149,000 Y50F probably benign Het
Oxct2b T C 4: 123,117,685 L466P probably damaging Het
Padi6 A G 4: 140,741,934 C32R probably damaging Het
Pla2r1 A T 2: 60,497,614 Y501* probably null Het
Rb1cc1 G A 1: 6,230,024 V8I probably damaging Het
Rexo5 A G 7: 119,827,398 probably benign Het
Tmem119 T C 5: 113,794,987 E251G probably benign Het
Vmn2r112 T A 17: 22,603,088 M249K probably benign Het
Zc2hc1a A G 3: 7,518,391 T41A probably benign Het
Zfp128 A G 7: 12,890,362 D219G probably benign Het
Znrf2 T C 6: 54,863,960 V173A possibly damaging Het
Other mutations in Elk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Elk3 APN 10 93284827 missense probably damaging 1.00
IGL02566:Elk3 APN 10 93265463 missense probably damaging 1.00
IGL03251:Elk3 APN 10 93254821 splice site probably null
R0308:Elk3 UTSW 10 93265205 missense probably benign
R0594:Elk3 UTSW 10 93265160 missense probably damaging 1.00
R0601:Elk3 UTSW 10 93265481 missense probably damaging 0.98
R1190:Elk3 UTSW 10 93265196 missense probably benign 0.00
R2021:Elk3 UTSW 10 93265677 missense probably damaging 1.00
R2022:Elk3 UTSW 10 93265677 missense probably damaging 1.00
R2418:Elk3 UTSW 10 93284827 missense probably damaging 1.00
R3935:Elk3 UTSW 10 93265173 missense possibly damaging 0.60
R4167:Elk3 UTSW 10 93265335 critical splice donor site probably null
R4169:Elk3 UTSW 10 93265335 critical splice donor site probably null
R4170:Elk3 UTSW 10 93265335 critical splice donor site probably null
R5864:Elk3 UTSW 10 93284791 missense probably damaging 1.00
R6171:Elk3 UTSW 10 93250044 missense probably damaging 1.00
R6743:Elk3 UTSW 10 93265050 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- AGGAAGAGGCTTCTGTGTTCAG -3'
(R):5'- TGTCCTCTCTCAAAAGTGCCAG -3'

Sequencing Primer
(F):5'- CTGTGTTCAGAAGGGAGGG -3'
(R):5'- GCCGCAACGAGTACCTC -3'
Posted On2015-06-12