Mutagenetix > Incidental Mutations

Incidental Mutation 'R4168:Padi6'

371092

Institutional Source

Beutler Lab

Gene Symbol

Padi6

Ensembl Gene

ENSMUSG00000040935

Gene Name

peptidyl arginine deiminase, type VI

Synonyms

Padi5, Pad6, ePAD

MMRRC Submission

041009-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4168 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

140727355-140742643 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 140741934 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 32 (C32R)

Ref Sequence

ENSEMBL: ENSMUSP00000044044 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026381] [ENSMUST00000038749] [ENSMUST00000130267]

AlphaFold

Q8K3V4

Predicted Effect

probably benign
Transcript: ENSMUST00000026381

SMART Domains

Protein: ENSMUSP00000026381
Gene: ENSMUSG00000025330

Domain	Start	End	E-Value	Type
Pfam:PAD_N	1	111	2.3e-38	PFAM
Pfam:PAD_M	113	273	2.4e-63	PFAM
Pfam:PAD	283	663	2.4e-176	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000038749
AA Change: C32R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000044044
Gene: ENSMUSG00000040935
AA Change: C32R

Domain	Start	End	E-Value	Type
Pfam:PAD_N	1	112	5.6e-38	PFAM
Pfam:PAD_M	114	269	6e-53	PFAM
Pfam:PAD	280	679	4.7e-149	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000130267

SMART Domains

Protein: ENSMUSP00000123490
Gene: ENSMUSG00000040935

Domain	Start	End	E-Value	Type
Pfam:PAD_M	39	191	1.1e-57	PFAM

Meta Mutation Damage Score

0.1584

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.2%
20x: 95.3%

Validation Efficiency

98% (39/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. This protein may play a role in cytoskeletal reorganization in the egg and in early embryo development. [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit altered oocyte cytoplasmic structures that lead to a failure of zygotes to progress beyond the 2 cell stage and female infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	T	C	7: 28,137,109	L151P	probably benign	Het
C3	A	T	17: 57,218,608	F883I	probably benign	Het
Cbr4	T	A	8: 61,491,521		probably benign	Het
Cd200r3	T	A	16: 44,954,189	D188E	probably benign	Het
Chpf2	T	C	5: 24,591,790	V578A	possibly damaging	Het
Clasrp	A	G	7: 19,581,154		probably benign	Het
Cmip	A	T	8: 117,456,917	N743I	probably damaging	Het
Ctif	A	C	18: 75,637,215	L33R	probably damaging	Het
Dmap1	T	A	4: 117,681,310	H54L	possibly damaging	Het
Elk3	A	G	10: 93,265,335		probably null	Het
Flt4	G	A	11: 49,630,573	R440H	probably benign	Het
Gabrb2	A	T	11: 42,421,328		probably benign	Het
Gm12789	A	G	4: 101,989,962	Y148C	possibly damaging	Het
Gm5724	T	C	6: 141,738,947	I261V	probably benign	Het
Haspin	A	G	11: 73,136,022	L747P	probably damaging	Het
Intu	C	T	3: 40,672,623	P278L	probably benign	Het
Kif27	A	G	13: 58,345,748	I127T	probably benign	Het
Mogat1	T	C	1: 78,512,035	V25A	possibly damaging	Het
Nop14	A	G	5: 34,656,744	S157P	probably damaging	Het
Olfr1040	A	G	2: 86,146,179	I185T	probably benign	Het
Olfr1167	T	C	2: 88,149,845	H58R	probably damaging	Het
Olfr195	A	T	16: 59,149,000	Y50F	probably benign	Het
Oxct2b	T	C	4: 123,117,685	L466P	probably damaging	Het
Pla2r1	A	T	2: 60,497,614	Y501*	probably null	Het
Rb1cc1	G	A	1: 6,230,024	V8I	probably damaging	Het
Rexo5	A	G	7: 119,827,398		probably benign	Het
Tmem119	T	C	5: 113,794,987	E251G	probably benign	Het
Vmn2r112	T	A	17: 22,603,088	M249K	probably benign	Het
Zc2hc1a	A	G	3: 7,518,391	T41A	probably benign	Het
Zfp128	A	G	7: 12,890,362	D219G	probably benign	Het
Znrf2	T	C	6: 54,863,960	V173A	possibly damaging	Het

Other mutations in Padi6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00778:Padi6	APN	4	140727623	missense	possibly damaging	0.56
IGL01013:Padi6	APN	4	140729003	missense	probably damaging	0.98
IGL01068:Padi6	APN	4	140730953	missense	possibly damaging	0.70
IGL01945:Padi6	APN	4	140741924	missense	probably benign	0.24
streetwise	UTSW	4	140741558	nonsense	probably null
R0097:Padi6	UTSW	4	140730957	missense	probably benign	0.09
R0097:Padi6	UTSW	4	140730957	missense	probably benign	0.09
R0135:Padi6	UTSW	4	140737352	missense	probably benign	0.04
R0437:Padi6	UTSW	4	140728929	missense	probably benign	0.01
R1581:Padi6	UTSW	4	140735836	missense	probably damaging	1.00
R2024:Padi6	UTSW	4	140728968	missense	possibly damaging	0.78
R3150:Padi6	UTSW	4	140735389	missense	probably damaging	1.00
R3176:Padi6	UTSW	4	140735389	missense	probably damaging	1.00
R3177:Padi6	UTSW	4	140735389	missense	probably damaging	1.00
R3276:Padi6	UTSW	4	140735389	missense	probably damaging	1.00
R3277:Padi6	UTSW	4	140735389	missense	probably damaging	1.00
R4727:Padi6	UTSW	4	140731195	missense	probably damaging	1.00
R5063:Padi6	UTSW	4	140741880	missense	probably benign	0.01
R5382:Padi6	UTSW	4	140731210	missense	probably damaging	1.00
R5408:Padi6	UTSW	4	140727685	missense	probably damaging	1.00
R5604:Padi6	UTSW	4	140731162	missense	probably damaging	0.96
R5790:Padi6	UTSW	4	140732258	missense	probably damaging	1.00
R7084:Padi6	UTSW	4	140741558	nonsense	probably null
R7533:Padi6	UTSW	4	140731195	missense	probably damaging	1.00
R7581:Padi6	UTSW	4	140728929	missense	probably benign	0.01
R7662:Padi6	UTSW	4	140728995	missense	probably benign	0.00
R7766:Padi6	UTSW	4	140730975	missense	probably benign	0.02
R7872:Padi6	UTSW	4	140727762	missense	probably damaging	1.00
R8333:Padi6	UTSW	4	140737376	missense	probably damaging	1.00
R8347:Padi6	UTSW	4	140735408	missense	probably benign	0.00
R8550:Padi6	UTSW	4	140732703	missense	probably benign	0.15
R8979:Padi6	UTSW	4	140739163	missense	probably benign	0.03
RF007:Padi6	UTSW	4	140729743	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAGGTTAAAGGTTACCCCTCTCCC -3'
(R):5'- ATCCATCAAAGGCGTGGAGG -3'

Sequencing Primer
(F):5'- GCTCACCTTGTCTTCATCCACAG -3'
(R):5'- ATGGATGCAGACTCCAGA -3'

Posted On

2016-02-16