Incidental Mutation 'R4259:Pdgfrb'
ID322587
Institutional Source Beutler Lab
Gene Symbol Pdgfrb
Ensembl Gene ENSMUSG00000024620
Gene Nameplatelet derived growth factor receptor, beta polypeptide
SynonymsCD140b, Pdgfr
MMRRC Submission 041072-MU
Accession Numbers

Ncbi RefSeq: NM_001146268.1, NM_008809.2; MGI:97531

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4259 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location61045150-61085061 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 61077631 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 737 (T737P)
Ref Sequence ENSEMBL: ENSMUSP00000110929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025522] [ENSMUST00000115274]
Predicted Effect probably benign
Transcript: ENSMUST00000025522
AA Change: T733P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000025522
Gene: ENSMUSG00000024620
AA Change: T733P

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
IG 38 120 5.58e-2 SMART
IGc2 225 297 2.83e-12 SMART
IG_like 330 402 1.47e0 SMART
Pfam:Ig_2 415 524 5.6e-2 PFAM
transmembrane domain 534 556 N/A INTRINSIC
TyrKc 600 958 1.11e-135 SMART
low complexity region 1063 1083 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115274
AA Change: T737P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110929
Gene: ENSMUSG00000024620
AA Change: T737P

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
IG 42 124 5.58e-2 SMART
IGc2 229 301 2.83e-12 SMART
IG_like 334 406 1.47e0 SMART
transmembrane domain 538 560 N/A INTRINSIC
TyrKc 604 962 1.11e-135 SMART
low complexity region 1067 1087 N/A INTRINSIC
Meta Mutation Damage Score 0.0645 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (40/41)
MGI Phenotype Strain: 2682393; 2135508
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface tyrosine kinase receptor for members of the platelet-derived growth factor family. These growth factors are mitogens for cells of mesenchymal origin. The identity of the growth factor bound to a receptor monomer determines whether the functional receptor is a homodimer or a heterodimer, composed of both platelet-derived growth factor receptor alpha and beta polypeptides. This gene is flanked on chromosome 5 by the genes for granulocyte-macrophage colony-stimulating factor and macrophage-colony stimulating factor receptor; all three genes may be implicated in the 5-q syndrome. A translocation between chromosomes 5 and 12, that fuses this gene to that of the translocation, ETV6, leukemia gene, results in chronic myeloproliferative disorder with eosinophilia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants die perinatally with internal bleeding, thrombocytopenia, anemia and kidney defects. A frameshift mutation results in neonatal lethals with edema and hemorrhaging; several point mutations show cardiovascular abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted(23) Gene trapped(2)

Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 8,995,234 S298P probably damaging Het
4930407I10Rik A G 15: 82,063,726 D608G possibly damaging Het
Actr10 T C 12: 70,952,985 V185A probably benign Het
Cd248 A G 19: 5,068,838 D238G probably damaging Het
Cep290 A C 10: 100,514,492 E649D probably damaging Het
Cyp2b19 G A 7: 26,763,382 G230S probably damaging Het
Dnah12 A G 14: 26,798,926 I1901V probably benign Het
Fam71f1 C G 6: 29,320,801 I141M probably damaging Het
Gpr171 A G 3: 59,097,527 S276P probably damaging Het
Hap1 C A 11: 100,351,842 probably null Het
Hcn1 A T 13: 117,975,348 K616M unknown Het
Igkv4-90 T C 6: 68,807,477 I18M possibly damaging Het
Itpr3 T A 17: 27,106,324 V1297E probably damaging Het
Kmt2b T C 7: 30,581,081 N1319D probably damaging Het
Krt72 T C 15: 101,778,257 E418G probably damaging Het
Lama1 T C 17: 67,752,418 S599P possibly damaging Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lrrk1 A T 7: 66,330,764 Y223N probably damaging Het
Olfr1076 A G 2: 86,508,999 D180G probably damaging Het
Olfr150 A T 9: 39,737,703 D296V probably damaging Het
Olfr480 T A 7: 108,065,893 K272* probably null Het
Pde6c G A 19: 38,162,845 G608S probably damaging Het
Pdk2 T C 11: 95,041,144 D38G probably benign Het
Pgk2 T G 17: 40,207,383 T385P probably benign Het
Prl3b1 T C 13: 27,243,906 probably null Het
Sat1 T C X: 155,215,186 probably benign Het
Sgo2b A T 8: 63,928,296 F501I probably benign Het
Sgsm2 T A 11: 74,892,028 H34L probably damaging Het
Slc26a1 T A 5: 108,672,630 K250N probably damaging Het
Slc38a4 A G 15: 96,998,493 Y498H probably damaging Het
Slc5a4b A G 10: 76,103,852 L150P probably damaging Het
Tbc1d32 A G 10: 56,049,771 S1093P probably damaging Het
Other mutations in Pdgfrb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Pdgfrb APN 18 61068936 missense probably benign 0.20
IGL01396:Pdgfrb APN 18 61072664 missense probably damaging 1.00
IGL02377:Pdgfrb APN 18 61080332 missense probably damaging 1.00
IGL02435:Pdgfrb APN 18 61064926 critical splice donor site probably null
IGL03397:Pdgfrb APN 18 61079681 missense probably benign 0.28
R0021:Pdgfrb UTSW 18 61064926 critical splice donor site probably benign
R0021:Pdgfrb UTSW 18 61064926 critical splice donor site probably benign
R0087:Pdgfrb UTSW 18 61061513 missense probably damaging 1.00
R0119:Pdgfrb UTSW 18 61068852 missense probably benign 0.06
R0299:Pdgfrb UTSW 18 61068852 missense probably benign 0.06
R0532:Pdgfrb UTSW 18 61083265 missense probably damaging 1.00
R0570:Pdgfrb UTSW 18 61077703 missense probably benign 0.00
R0629:Pdgfrb UTSW 18 61078648 critical splice donor site probably null
R0650:Pdgfrb UTSW 18 61079708 missense probably benign 0.00
R0853:Pdgfrb UTSW 18 61080327 missense probably damaging 1.00
R1165:Pdgfrb UTSW 18 61064002 missense probably benign 0.01
R1342:Pdgfrb UTSW 18 61065880 nonsense probably null
R1740:Pdgfrb UTSW 18 61081833 missense possibly damaging 0.93
R1808:Pdgfrb UTSW 18 61068102 missense probably benign
R1864:Pdgfrb UTSW 18 61071717 missense probably benign 0.00
R1960:Pdgfrb UTSW 18 61065783 missense probably benign 0.05
R1961:Pdgfrb UTSW 18 61061505 missense possibly damaging 0.49
R1970:Pdgfrb UTSW 18 61066494 splice site probably benign
R2011:Pdgfrb UTSW 18 61061494 missense probably benign 0.01
R2012:Pdgfrb UTSW 18 61061494 missense probably benign 0.01
R2018:Pdgfrb UTSW 18 61083334 missense possibly damaging 0.84
R2153:Pdgfrb UTSW 18 61072756 missense probably damaging 1.00
R2497:Pdgfrb UTSW 18 61078628 missense possibly damaging 0.58
R2846:Pdgfrb UTSW 18 61064016 missense probably benign 0.00
R3776:Pdgfrb UTSW 18 61081920 missense probably benign 0.00
R3779:Pdgfrb UTSW 18 61072666 missense probably damaging 1.00
R3816:Pdgfrb UTSW 18 61078945 missense probably damaging 1.00
R3978:Pdgfrb UTSW 18 61073685 missense probably damaging 1.00
R4261:Pdgfrb UTSW 18 61077631 missense probably benign 0.00
R4327:Pdgfrb UTSW 18 61071720 missense possibly damaging 0.83
R4329:Pdgfrb UTSW 18 61071720 missense possibly damaging 0.83
R4598:Pdgfrb UTSW 18 61068757 missense probably benign 0.03
R4668:Pdgfrb UTSW 18 61064113 missense probably damaging 1.00
R4761:Pdgfrb UTSW 18 61079700 missense probably damaging 1.00
R4787:Pdgfrb UTSW 18 61079687 missense probably damaging 1.00
R4828:Pdgfrb UTSW 18 61073243 missense probably damaging 0.98
R5030:Pdgfrb UTSW 18 61065135 missense probably benign 0.13
R5033:Pdgfrb UTSW 18 61077668 missense probably damaging 1.00
R5447:Pdgfrb UTSW 18 61068108 missense probably damaging 1.00
R6224:Pdgfrb UTSW 18 61081939 nonsense probably null
R6807:Pdgfrb UTSW 18 61078649 critical splice donor site probably null
R6858:Pdgfrb UTSW 18 61065147 missense probably benign 0.01
R7017:Pdgfrb UTSW 18 61081004 missense probably benign 0.00
R7089:Pdgfrb UTSW 18 61073243 missense probably damaging 1.00
R7174:Pdgfrb UTSW 18 61066515 missense probably benign
R7374:Pdgfrb UTSW 18 61071708 missense possibly damaging 0.64
R7496:Pdgfrb UTSW 18 61078932 missense possibly damaging 0.71
R7565:Pdgfrb UTSW 18 61083264 missense probably damaging 1.00
R7615:Pdgfrb UTSW 18 61064046 missense probably benign 0.00
R7691:Pdgfrb UTSW 18 61061268 missense probably benign 0.05
R7884:Pdgfrb UTSW 18 61072658 missense probably damaging 1.00
R7967:Pdgfrb UTSW 18 61072658 missense probably damaging 1.00
X0060:Pdgfrb UTSW 18 61081976 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCACACAGGTTAGTTGAAGGG -3'
(R):5'- AAGGAAGACATTGCTGTGCG -3'

Sequencing Primer
(F):5'- GGGTTTGGTTCACAGTCATTCACAC -3'
(R):5'- AAGGAAGACATTGCTGTGCGTATTG -3'
Posted On2015-06-20