Incidental Mutation 'R4291:AK157302'
ID323077
Institutional Source Beutler Lab
Gene Symbol AK157302
Ensembl Gene ENSMUSG00000078139
Gene NamecDNA sequence AK157302
Synonyms
MMRRC Submission 041081-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.939) question?
Stock #R4291 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location21495223-21497146 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21495545 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 80 (D80E)
Ref Sequence ENSEMBL: ENSMUSP00000100547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104942]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000041159
AA Change: D80E
Predicted Effect probably damaging
Transcript: ENSMUST00000104942
AA Change: D80E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100547
Gene: ENSMUSG00000078139
AA Change: D80E

DomainStartEndE-ValueType
Pfam:Fe-S_biosyn 23 125 7e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202287
AA Change: D80E
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,066,188 F27S probably benign Het
Amz2 T C 11: 109,434,055 probably null Het
Angel1 A G 12: 86,720,283 Y440H probably damaging Het
Ankrd34c T A 9: 89,729,764 K175* probably null Het
Arid1b C A 17: 5,040,663 S546R probably damaging Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Brpf3 G A 17: 28,823,975 V997M probably benign Het
Cckar A G 5: 53,706,497 S41P probably benign Het
Cd96 T A 16: 46,071,749 Q292L probably damaging Het
Cdh18 C A 15: 22,714,551 probably benign Het
Cfb T G 17: 34,861,138 D122A possibly damaging Het
Copa G T 1: 172,092,397 probably benign Het
Ctnna2 T A 6: 76,882,745 K854N probably damaging Het
Cwh43 G A 5: 73,411,932 V106M probably benign Het
Dact2 C T 17: 14,196,571 E456K probably benign Het
Dnah8 T C 17: 30,748,559 S2582P probably benign Het
Eef2 A G 10: 81,179,580 T312A probably benign Het
Enpep T A 3: 129,270,317 R934* probably null Het
Fam240b A T 13: 64,481,813 M63K possibly damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm6124 A T 7: 39,222,771 noncoding transcript Het
Gsn G A 2: 35,290,420 V147I probably benign Het
Gucy1a1 A T 3: 82,094,759 F671Y possibly damaging Het
Hectd3 A G 4: 116,995,692 E97G probably damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Krba1 C T 6: 48,415,665 P802S possibly damaging Het
Lca5l C T 16: 96,178,774 S52N probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Map3k4 G T 17: 12,255,260 Q845K probably benign Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mccc1 A G 3: 35,990,068 V203A probably damaging Het
Mcm9 C A 10: 53,547,572 M677I probably benign Het
Mkrn2 A G 6: 115,617,434 T369A possibly damaging Het
Mthfr C A 4: 148,055,492 N623K probably damaging Het
Myh2 T C 11: 67,181,159 V571A probably benign Het
Nom1 G A 5: 29,446,372 probably null Het
Nucb1 T A 7: 45,495,280 D283V probably damaging Het
Olfr1120 G A 2: 87,358,075 M210I probably benign Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Olfr310 A T 7: 86,269,760 F10I probably damaging Het
Pcdhb1 A C 18: 37,265,417 L140F probably damaging Het
Ptgs2 G A 1: 150,100,251 A10T probably benign Het
Rfx3 C T 19: 27,800,232 R497Q probably damaging Het
Rps6kb1 A T 11: 86,519,876 probably benign Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Tet3 T C 6: 83,373,199 T961A probably damaging Het
Ttc27 T C 17: 74,856,479 L694P probably damaging Het
Vmn1r238 G A 18: 3,123,214 Q67* probably null Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Vwf A T 6: 125,642,322 Y1321F probably damaging Het
Wfdc1 C A 8: 119,679,455 P103Q probably damaging Het
Zfp488 C A 14: 33,970,894 C104F possibly damaging Het
Other mutations in AK157302
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01366:AK157302 APN 13 21495301 utr 5 prime probably benign
Benjamin UTSW 13 21495663 missense possibly damaging 0.84
R0610:AK157302 UTSW 13 21495663 missense possibly damaging 0.84
R2155:AK157302 UTSW 13 21495657 nonsense probably null
R2378:AK157302 UTSW 13 21495562 missense possibly damaging 0.69
R4477:AK157302 UTSW 13 21495691 missense possibly damaging 0.51
R5887:AK157302 UTSW 13 21495409 missense possibly damaging 0.95
R6608:AK157302 UTSW 13 21495624 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGGAGAGAAGCTGAGTCCC -3'
(R):5'- GCTCACAGTCCTGAGGTTTC -3'

Sequencing Primer
(F):5'- AAGCTGAGTCCCCACGCTC -3'
(R):5'- ACAGTCCTGAGGTTTCACACGTG -3'
Posted On2015-06-20