Incidental Mutation 'R4291:Tet3'
ID323059
Institutional Source Beutler Lab
Gene Symbol Tet3
Ensembl Gene ENSMUSG00000034832
Gene Nametet methylcytosine dioxygenase 3
SynonymsD230004J03Rik, B430006D22Rik
MMRRC Submission 041081-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.569) question?
Stock #R4291 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location83362373-83459084 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83373199 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 961 (T961A)
Ref Sequence ENSEMBL: ENSMUSP00000087049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089622] [ENSMUST00000186548]
Predicted Effect probably damaging
Transcript: ENSMUST00000089622
AA Change: T961A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087049
Gene: ENSMUSG00000034832
AA Change: T961A

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
low complexity region 66 77 N/A INTRINSIC
low complexity region 115 126 N/A INTRINSIC
internal_repeat_1 160 277 4.9e-5 PROSPERO
low complexity region 279 297 N/A INTRINSIC
low complexity region 359 371 N/A INTRINSIC
low complexity region 418 456 N/A INTRINSIC
Tet_JBP 858 1570 N/A SMART
coiled coil region 1579 1603 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186548
AA Change: T1096A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139630
Gene: ENSMUSG00000034832
AA Change: T1096A

DomainStartEndE-ValueType
Pfam:zf-CXXC 49 89 8e-6 PFAM
low complexity region 162 173 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 250 261 N/A INTRINSIC
internal_repeat_1 295 412 5.5e-5 PROSPERO
low complexity region 414 432 N/A INTRINSIC
low complexity region 494 506 N/A INTRINSIC
low complexity region 553 591 N/A INTRINSIC
Tet_JBP 993 1705 N/A SMART
coiled coil region 1714 1738 N/A INTRINSIC
Meta Mutation Damage Score 0.3086 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the ten-eleven translocation (TET) gene family, including TET3, play a role in the DNA methylation process (Langemeijer et al., 2009 [PubMed 19923888]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice inheriting a null allele from a germ cell conditional null mother display impaired reprogramming of the paternal genome resulting in reduced embryo viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,066,188 F27S probably benign Het
AK157302 T A 13: 21,495,545 D80E probably damaging Het
Amz2 T C 11: 109,434,055 probably null Het
Angel1 A G 12: 86,720,283 Y440H probably damaging Het
Ankrd34c T A 9: 89,729,764 K175* probably null Het
Arid1b C A 17: 5,040,663 S546R probably damaging Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Brpf3 G A 17: 28,823,975 V997M probably benign Het
Cckar A G 5: 53,706,497 S41P probably benign Het
Cd96 T A 16: 46,071,749 Q292L probably damaging Het
Cdh18 C A 15: 22,714,551 probably benign Het
Cfb T G 17: 34,861,138 D122A possibly damaging Het
Copa G T 1: 172,092,397 probably benign Het
Ctnna2 T A 6: 76,882,745 K854N probably damaging Het
Cwh43 G A 5: 73,411,932 V106M probably benign Het
Dact2 C T 17: 14,196,571 E456K probably benign Het
Dnah8 T C 17: 30,748,559 S2582P probably benign Het
Eef2 A G 10: 81,179,580 T312A probably benign Het
Enpep T A 3: 129,270,317 R934* probably null Het
Fam240b A T 13: 64,481,813 M63K possibly damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm6124 A T 7: 39,222,771 noncoding transcript Het
Gsn G A 2: 35,290,420 V147I probably benign Het
Gucy1a1 A T 3: 82,094,759 F671Y possibly damaging Het
Hectd3 A G 4: 116,995,692 E97G probably damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Krba1 C T 6: 48,415,665 P802S possibly damaging Het
Lca5l C T 16: 96,178,774 S52N probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Map3k4 G T 17: 12,255,260 Q845K probably benign Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mccc1 A G 3: 35,990,068 V203A probably damaging Het
Mcm9 C A 10: 53,547,572 M677I probably benign Het
Mkrn2 A G 6: 115,617,434 T369A possibly damaging Het
Mthfr C A 4: 148,055,492 N623K probably damaging Het
Myh2 T C 11: 67,181,159 V571A probably benign Het
Nom1 G A 5: 29,446,372 probably null Het
Nucb1 T A 7: 45,495,280 D283V probably damaging Het
Olfr1120 G A 2: 87,358,075 M210I probably benign Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Olfr310 A T 7: 86,269,760 F10I probably damaging Het
Pcdhb1 A C 18: 37,265,417 L140F probably damaging Het
Ptgs2 G A 1: 150,100,251 A10T probably benign Het
Rfx3 C T 19: 27,800,232 R497Q probably damaging Het
Rps6kb1 A T 11: 86,519,876 probably benign Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Ttc27 T C 17: 74,856,479 L694P probably damaging Het
Vmn1r238 G A 18: 3,123,214 Q67* probably null Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Vwf A T 6: 125,642,322 Y1321F probably damaging Het
Wfdc1 C A 8: 119,679,455 P103Q probably damaging Het
Zfp488 C A 14: 33,970,894 C104F possibly damaging Het
Other mutations in Tet3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Tet3 APN 6 83368655 missense probably benign 0.06
IGL01396:Tet3 APN 6 83369638 nonsense probably null
IGL02344:Tet3 APN 6 83403833 missense probably benign 0.04
IGL02987:Tet3 APN 6 83368092 missense probably damaging 0.99
IGL03126:Tet3 APN 6 83376787 missense probably damaging 1.00
IGL03155:Tet3 APN 6 83368383 missense probably damaging 1.00
IGL03286:Tet3 APN 6 83375778 missense probably damaging 1.00
Reedy UTSW 6 83368084 nonsense probably null
P0033:Tet3 UTSW 6 83368512 missense probably damaging 1.00
R0131:Tet3 UTSW 6 83368788 missense probably damaging 1.00
R0295:Tet3 UTSW 6 83369139 missense probably benign 0.14
R0504:Tet3 UTSW 6 83373794 missense probably damaging 1.00
R0524:Tet3 UTSW 6 83379942 missense probably damaging 1.00
R1061:Tet3 UTSW 6 83373323 missense probably damaging 0.99
R1160:Tet3 UTSW 6 83404452 missense probably benign 0.00
R1550:Tet3 UTSW 6 83386028 missense probably damaging 0.97
R1640:Tet3 UTSW 6 83369315 missense probably benign 0.44
R1658:Tet3 UTSW 6 83369057 missense probably benign 0.44
R1746:Tet3 UTSW 6 83368068 missense probably damaging 1.00
R1761:Tet3 UTSW 6 83403659 missense probably damaging 0.99
R1832:Tet3 UTSW 6 83403645 missense probably benign
R1835:Tet3 UTSW 6 83404163 missense possibly damaging 0.95
R1932:Tet3 UTSW 6 83404379 missense possibly damaging 0.94
R2014:Tet3 UTSW 6 83386075 missense probably damaging 1.00
R2230:Tet3 UTSW 6 83369471 missense probably damaging 1.00
R2232:Tet3 UTSW 6 83369471 missense probably damaging 1.00
R2922:Tet3 UTSW 6 83368512 missense probably damaging 1.00
R3429:Tet3 UTSW 6 83403419 missense probably damaging 1.00
R3430:Tet3 UTSW 6 83403419 missense probably damaging 1.00
R4349:Tet3 UTSW 6 83403275 missense probably benign
R4809:Tet3 UTSW 6 83402946 missense probably benign
R4846:Tet3 UTSW 6 83376883 nonsense probably null
R5039:Tet3 UTSW 6 83375896 missense probably damaging 1.00
R5233:Tet3 UTSW 6 83386063 missense probably damaging 1.00
R5363:Tet3 UTSW 6 83376764 critical splice donor site probably null
R5880:Tet3 UTSW 6 83370550 missense probably damaging 1.00
R6270:Tet3 UTSW 6 83375791 missense possibly damaging 0.86
R6277:Tet3 UTSW 6 83368084 nonsense probably null
R6564:Tet3 UTSW 6 83386070 missense possibly damaging 0.92
R6622:Tet3 UTSW 6 83403444 missense probably benign 0.00
R7089:Tet3 UTSW 6 83455024 missense possibly damaging 0.46
R7244:Tet3 UTSW 6 83370621 missense probably damaging 1.00
R7251:Tet3 UTSW 6 83404056 missense probably benign
R7361:Tet3 UTSW 6 83368094 missense probably benign 0.15
R7436:Tet3 UTSW 6 83368229 small insertion probably benign
R7438:Tet3 UTSW 6 83368229 small insertion probably benign
R7544:Tet3 UTSW 6 83404641 missense probably damaging 1.00
R7552:Tet3 UTSW 6 83368307 missense probably damaging 1.00
R7942:Tet3 UTSW 6 83376974 missense probably damaging 1.00
R8010:Tet3 UTSW 6 83403246 missense unknown
R8063:Tet3 UTSW 6 83402741 missense probably damaging 1.00
R8307:Tet3 UTSW 6 83379927 missense probably damaging 1.00
X0004:Tet3 UTSW 6 83403423 missense probably benign 0.17
Z1176:Tet3 UTSW 6 83370698 missense probably damaging 1.00
Z1176:Tet3 UTSW 6 83404350 missense probably damaging 1.00
Z1176:Tet3 UTSW 6 83459021 missense unknown
Z1177:Tet3 UTSW 6 83404294 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TCACACGTTGGCTCTGGTTC -3'
(R):5'- TAACCTGCTCCTCTCTAAGATCTGG -3'

Sequencing Primer
(F):5'- GGCTCTGGTTCCTCGCATG -3'
(R):5'- TCGGGGCTGGTCACTCAG -3'
Posted On2015-06-20