Mutagenetix > Incidental Mutation

Incidental Mutation 'R4330:Hrh3'

324559

Institutional Source

Beutler Lab

Gene Symbol

Hrh3

Ensembl Gene

ENSMUSG00000039059

Gene Name

histamine receptor H3

Synonyms

Eae8

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.333) question?

Stock #

R4330 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

179741258-179746264 bp(-) (GRCm39)

Type of Mutation

unclassified

DNA Base Change (assembly)

T to C at 179741665 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000127085 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056480] [ENSMUST00000163215] [ENSMUST00000164442] [ENSMUST00000165248] [ENSMUST00000165762] [ENSMUST00000166724] [ENSMUST00000171736]

AlphaFold

P58406

Predicted Effect

probably benign
Transcript: ENSMUST00000056480

SMART Domains

Protein: ENSMUSP00000049963
Gene: ENSMUSG00000039059

Domain	Start	End	E-Value	Type
low complexity region	12	50	N/A	INTRINSIC
Pfam:7tm_1	51	412	7.2e-65	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000163215
AA Change: M394V

SMART Domains

Protein: ENSMUSP00000127053
Gene: ENSMUSG00000039059
AA Change: M394V

Domain	Start	End	E-Value	Type
low complexity region	12	50	N/A	INTRINSIC
Pfam:7tm_1	51	376	2e-55	PFAM
low complexity region	406	415	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000164442

SMART Domains

Protein: ENSMUSP00000130553
Gene: ENSMUSG00000039059

Domain	Start	End	E-Value	Type
low complexity region	12	50	N/A	INTRINSIC
Pfam:7tm_1	51	380	4.8e-65	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000165248

SMART Domains

Protein: ENSMUSP00000130181
Gene: ENSMUSG00000039059

Domain	Start	End	E-Value	Type
low complexity region	12	50	N/A	INTRINSIC
Pfam:7tm_1	51	364	6.9e-65	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000165762

SMART Domains

Protein: ENSMUSP00000132203
Gene: ENSMUSG00000039059

Domain	Start	End	E-Value	Type
low complexity region	12	50	N/A	INTRINSIC
Pfam:7tm_1	51	412	1.3e-64	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166392

Predicted Effect

probably benign
Transcript: ENSMUST00000166724

SMART Domains

Protein: ENSMUSP00000126336
Gene: ENSMUSG00000039059

Domain	Start	End	E-Value	Type
low complexity region	12	50	N/A	INTRINSIC
Pfam:7tm_1	51	93	1.8e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172211

Predicted Effect

probably benign
Transcript: ENSMUST00000171736

SMART Domains

Protein: ENSMUSP00000127085
Gene: ENSMUSG00000039059

Domain	Start	End	E-Value	Type
low complexity region	12	50	N/A	INTRINSIC
Pfam:7tm_1	51	239	5.2e-45	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histamine is a ubiquitous messenger molecule released from mast cells, enterochromaffin-like cells, and neurons. Its various actions are mediated by histamine receptors H1, H2, H3 and H4. This gene encodes one of the histamine receptors (H3) which belongs to the family 1 of G protein-coupled receptors. It is an integral membrane protein and can regulate neurotransmitter release. This receptor can also increase voltage-dependent calcium current in smooth muscles and innervates the blood vessels and the heart in cardiovascular system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced locomotor activity and body temperature, and attenuated behavioral responses to the drugs thioperamide, methamphetamine, and scopolamine. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 23 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam34l	T	A	8: 44,079,287 (GRCm39)	K312N	probably benign	Het
Arl6ip1	AAAATAAATAAATAAATAAATAAATA	AAAATAAATAAATAAATAAATAAATAAATA	7: 117,721,122 (GRCm39)		probably benign	Het
Cdh10	G	A	15: 19,000,045 (GRCm39)	V497I	probably damaging	Het
Chd4	T	C	6: 125,078,565 (GRCm39)	V229A	probably benign	Het
Cnr2	T	A	4: 135,644,237 (GRCm39)	I105N	possibly damaging	Het
Dnai1	A	G	4: 41,637,966 (GRCm39)	T701A	probably damaging	Het
Eri1	G	A	8: 35,936,383 (GRCm39)	R313*	probably null	Het
Hs3st5	T	A	10: 36,708,726 (GRCm39)	V87D	probably benign	Het
Jmy	G	C	13: 93,635,390 (GRCm39)	P142R	probably damaging	Het
Jmy	C	A	13: 93,635,781 (GRCm39)	D12Y	probably damaging	Het
Mfsd4a	A	C	1: 131,981,291 (GRCm39)	M320R	possibly damaging	Het
Myocd	A	T	11: 65,114,590 (GRCm39)	H49Q	probably benign	Het
Nlk	A	G	11: 78,481,774 (GRCm39)	I229T	possibly damaging	Het
Rabl2	T	C	15: 89,471,137 (GRCm39)	D66G	probably benign	Het
Ramp1	C	T	1: 91,151,067 (GRCm39)	T144I	possibly damaging	Het
Rhbdf2	T	C	11: 116,492,782 (GRCm39)	K413R	probably benign	Het
Scpep1	G	A	11: 88,826,729 (GRCm39)	Q236*	probably null	Het
Stil	A	G	4: 114,862,176 (GRCm39)	R40G	probably damaging	Het
Syt7	T	C	19: 10,399,162 (GRCm39)	V86A	probably damaging	Het
Ubr2	A	T	17: 47,278,204 (GRCm39)	L711Q	probably null	Het
Vmn1r78	T	A	7: 11,886,386 (GRCm39)		probably null	Het
Zfp280d	C	T	9: 72,203,261 (GRCm39)	T3I	possibly damaging	Het
Zscan25	T	A	5: 145,227,361 (GRCm39)	F342I	probably damaging	Het

Other mutations in Hrh3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01652:Hrh3	APN	2	179,742,896 (GRCm39)	missense	possibly damaging	0.69
IGL01827:Hrh3	APN	2	179,745,739 (GRCm39)	missense	possibly damaging	0.95
IGL01912:Hrh3	APN	2	179,743,169 (GRCm39)	missense	probably damaging	1.00
IGL02992:Hrh3	APN	2	179,742,608 (GRCm39)	missense	probably benign	0.11
IGL03273:Hrh3	APN	2	179,742,441 (GRCm39)	missense	possibly damaging	0.85
R1403:Hrh3	UTSW	2	179,744,547 (GRCm39)	missense	probably damaging	1.00
R1403:Hrh3	UTSW	2	179,744,547 (GRCm39)	missense	probably damaging	1.00
R1808:Hrh3	UTSW	2	179,741,577 (GRCm39)	unclassified	probably benign
R2060:Hrh3	UTSW	2	179,743,043 (GRCm39)	missense	possibly damaging	0.95
R4110:Hrh3	UTSW	2	179,744,643 (GRCm39)	missense	possibly damaging	0.84
R4111:Hrh3	UTSW	2	179,744,643 (GRCm39)	missense	possibly damaging	0.84
R4113:Hrh3	UTSW	2	179,744,643 (GRCm39)	missense	possibly damaging	0.84
R4935:Hrh3	UTSW	2	179,743,061 (GRCm39)	missense	probably damaging	1.00
R5050:Hrh3	UTSW	2	179,742,350 (GRCm39)	missense	probably damaging	1.00
R5543:Hrh3	UTSW	2	179,745,763 (GRCm39)	missense	probably damaging	0.99
R5780:Hrh3	UTSW	2	179,742,608 (GRCm39)	missense	probably damaging	0.96
R7571:Hrh3	UTSW	2	179,743,079 (GRCm39)	missense	probably damaging	0.98
R8699:Hrh3	UTSW	2	179,743,149 (GRCm39)	missense	probably damaging	0.99
R9603:Hrh3	UTSW	2	179,742,444 (GRCm39)	nonsense	probably null
R9698:Hrh3	UTSW	2	179,743,206 (GRCm39)	missense	possibly damaging	0.59

Predicted Primers

PCR Primer
(F):5'- AATTCTGACTGCGCAGATGGG -3'
(R):5'- TCTCTCCCAAGACGATCTGG -3'

Sequencing Primer
(F):5'- CGCAGATGGGGCAAGCAG -3'
(R):5'- AGACGATCTGGGGCGATGC -3'

Posted On

2015-06-24