Incidental Mutation 'R4412:Ms4a12'
ID327992
Institutional Source Beutler Lab
Gene Symbol Ms4a12
Ensembl Gene ENSMUSG00000101031
Gene Namemembrane-spanning 4-domains, subfamily A, member 12
SynonymsLOC381213
MMRRC Submission 041135-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4412 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location11215010-11230540 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11230443 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 33 (N33S)
Ref Sequence ENSEMBL: ENSMUSP00000140981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000186228]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181137
Predicted Effect probably benign
Transcript: ENSMUST00000186228
AA Change: N33S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140981
Gene: ENSMUSG00000101031
AA Change: N33S

DomainStartEndE-ValueType
Pfam:CD20 85 220 9.6e-24 PFAM
low complexity region 230 241 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cell surface protein found primarily in the apical membrane of colonocytes. Silencing of this gene in colon cancer cells inhibits the proliferation, cell motility, and chemotactic invasion of cells. This gene is part of a cluster of similar genes found on chromosome 11. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 T C 15: 74,577,453 probably benign Het
Adprhl1 T C 8: 13,246,114 K144E probably benign Het
Alpl A G 4: 137,758,628 I2T possibly damaging Het
Chdh G T 14: 30,031,715 G194C probably damaging Het
Cp A T 3: 19,966,353 D170V probably damaging Het
Cpne9 A G 6: 113,290,001 K132E possibly damaging Het
Cyp2b9 T G 7: 26,198,443 L224R probably damaging Het
Dmxl1 A G 18: 49,848,761 N153S probably benign Het
Dnah17 T C 11: 118,073,683 Y2423C probably damaging Het
Dnajc14 G T 10: 128,806,205 probably benign Het
Eipr1 A T 12: 28,859,373 D213V probably damaging Het
Fat1 T C 8: 45,023,599 V1894A probably damaging Het
Flrt2 G A 12: 95,780,273 V462I probably benign Het
Gigyf2 A G 1: 87,436,860 E954G probably damaging Het
Glis1 A G 4: 107,634,718 H593R probably damaging Het
Gpr21 C G 2: 37,517,432 probably benign Het
Gsdmc3 A G 15: 63,866,796 M139T probably benign Het
Hydin C T 8: 110,415,736 T749I probably damaging Het
Ilf3 C T 9: 21,399,560 P620S possibly damaging Het
Khdc3 A G 9: 73,102,874 T71A possibly damaging Het
Nisch A G 14: 31,186,658 probably benign Het
Npr2 G A 4: 43,644,150 C593Y probably damaging Het
Npr3 G C 15: 11,905,149 T164R probably benign Het
Olfr1231 A G 2: 89,303,340 I84T probably benign Het
Palld A G 8: 61,687,372 Y534H probably damaging Het
Pcdhb10 TC T 18: 37,414,141 probably null Het
Plekhg3 A C 12: 76,577,764 T1127P probably damaging Het
Podnl1 A T 8: 84,130,665 H301L probably benign Het
Ripk2 A G 4: 16,124,511 V399A probably benign Het
Rpp30 T A 19: 36,100,255 N172K possibly damaging Het
Sin3b C T 8: 72,739,779 A291V probably benign Het
Slc12a6 A T 2: 112,335,888 Q204L possibly damaging Het
Snx9 C T 17: 5,908,394 T249M probably damaging Het
Sohlh2 C A 3: 55,197,002 T264K probably damaging Het
Srrm2 A G 17: 23,810,468 probably benign Het
Syne2 T A 12: 76,106,060 H6674Q probably benign Het
Tyw1 T A 5: 130,335,232 probably null Het
Vmn1r115 C T 7: 20,844,282 R235K probably benign Het
Vmn2r50 A C 7: 10,050,308 F80V probably damaging Het
Yme1l1 G A 2: 23,175,187 R236H probably damaging Het
Other mutations in Ms4a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6114:Ms4a12 UTSW 19 11215290 missense probably benign 0.36
R6432:Ms4a12 UTSW 19 11215012 makesense probably null
R7453:Ms4a12 UTSW 19 11225662 nonsense probably null
R7897:Ms4a12 UTSW 19 11230359 missense possibly damaging 0.91
R8707:Ms4a12 UTSW 19 11215372 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- CTTACCCCAAGTGCTATTGCTG -3'
(R):5'- TTCTTGTCACTAGCCAGTATGTGC -3'

Sequencing Primer
(F):5'- CAAGTGCTATTGCTGCATCTTTAAC -3'
(R):5'- AGCCAGTATGTGCTCACTTG -3'
Posted On2015-07-07