Mutagenetix > Incidental Mutation

Incidental Mutation 'R4412:Npr2'

327958

Institutional Source

Beutler Lab

Gene Symbol

Npr2

Ensembl Gene

ENSMUSG00000028469

Gene Name

natriuretic peptide receptor 2

Synonyms

pwe, cn, guanylyl cyclase-B

MMRRC Submission

041135-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.782) question?

Stock #

R4412 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

43631935-43651244 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 43644150 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 593 (C593Y)

Ref Sequence

ENSEMBL: ENSMUSP00000030191 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030191] [ENSMUST00000107874]

AlphaFold

Q6VVW5

Predicted Effect

probably damaging
Transcript: ENSMUST00000030191
AA Change: C593Y

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000030191
Gene: ENSMUSG00000028469
AA Change: C593Y

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	44	399	1.9e-45	PFAM
Pfam:Pkinase_Tyr	518	786	4.7e-39	PFAM
Pfam:Pkinase	535	785	1.2e-32	PFAM
CYCc	825	1019	3.28e-111	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107874
AA Change: C593Y

PolyPhen 2 Score 0.627 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000103506
Gene: ENSMUSG00000028469
AA Change: C593Y

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	44	399	5.7e-56	PFAM
Pfam:Pkinase_Tyr	518	786	4.1e-39	PFAM
Pfam:Pkinase	533	785	3.8e-34	PFAM
CYCc	825	989	4.37e-57	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000123351
AA Change: C139Y

SMART Domains

Protein: ENSMUSP00000117761
Gene: ENSMUSG00000028469
AA Change: C139Y

Domain	Start	End	E-Value	Type
transmembrane domain	28	50	N/A	INTRINSIC
Pfam:Pkinase_Tyr	71	173	1.3e-12	PFAM
Pfam:Pkinase	85	170	1.2e-10	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123883

Predicted Effect

unknown
Transcript: ENSMUST00000128549
AA Change: C158Y

SMART Domains

Protein: ENSMUSP00000114385
Gene: ENSMUSG00000028469
AA Change: C158Y

Domain	Start	End	E-Value	Type
transmembrane domain	21	43	N/A	INTRINSIC
Pfam:Pkinase_Tyr	84	352	1e-39	PFAM
Pfam:Pkinase	101	351	2.6e-33	PFAM
CYCc	391	585	3.28e-111	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130093

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137535

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143160

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144418

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145817

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151603

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes natriuretic peptide receptor B, one of two integral membrane receptors for natriuretic peptides. Both NPR1 and NPR2 contain five functional domains: an extracellular ligand-binding domain, a single membrane-spanning region, and intracellularly a protein kinase homology domain, a helical hinge region involved in oligomerization, and a carboxyl-terminal guanylyl cyclase catalytic domain. The protein is the primary receptor for C-type natriuretic peptide (CNP), which upon ligand binding exhibits greatly increased guanylyl cyclase activity. Mutations in this gene are the cause of acromesomelic dysplasia Maroteaux type. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in skeletal abnormalities, malocclusion, and reduced viability. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrb1	T	C	15: 74,577,453		probably benign	Het
Adprhl1	T	C	8: 13,246,114	K144E	probably benign	Het
Alpl	A	G	4: 137,758,628	I2T	possibly damaging	Het
Chdh	G	T	14: 30,031,715	G194C	probably damaging	Het
Cp	A	T	3: 19,966,353	D170V	probably damaging	Het
Cpne9	A	G	6: 113,290,001	K132E	possibly damaging	Het
Cyp2b9	T	G	7: 26,198,443	L224R	probably damaging	Het
Dmxl1	A	G	18: 49,848,761	N153S	probably benign	Het
Dnah17	T	C	11: 118,073,683	Y2423C	probably damaging	Het
Dnajc14	G	T	10: 128,806,205		probably benign	Het
Eipr1	A	T	12: 28,859,373	D213V	probably damaging	Het
Fat1	T	C	8: 45,023,599	V1894A	probably damaging	Het
Flrt2	G	A	12: 95,780,273	V462I	probably benign	Het
Gigyf2	A	G	1: 87,436,860	E954G	probably damaging	Het
Glis1	A	G	4: 107,634,718	H593R	probably damaging	Het
Gpr21	C	G	2: 37,517,432		probably benign	Het
Gsdmc3	A	G	15: 63,866,796	M139T	probably benign	Het
Hydin	C	T	8: 110,415,736	T749I	probably damaging	Het
Ilf3	C	T	9: 21,399,560	P620S	possibly damaging	Het
Khdc3	A	G	9: 73,102,874	T71A	possibly damaging	Het
Ms4a12	T	C	19: 11,230,443	N33S	probably benign	Het
Nisch	A	G	14: 31,186,658		probably benign	Het
Npr3	G	C	15: 11,905,149	T164R	probably benign	Het
Olfr1231	A	G	2: 89,303,340	I84T	probably benign	Het
Palld	A	G	8: 61,687,372	Y534H	probably damaging	Het
Pcdhb10	TC	T	18: 37,414,141		probably null	Het
Plekhg3	A	C	12: 76,577,764	T1127P	probably damaging	Het
Podnl1	A	T	8: 84,130,665	H301L	probably benign	Het
Ripk2	A	G	4: 16,124,511	V399A	probably benign	Het
Rpp30	T	A	19: 36,100,255	N172K	possibly damaging	Het
Sin3b	C	T	8: 72,739,779	A291V	probably benign	Het
Slc12a6	A	T	2: 112,335,888	Q204L	possibly damaging	Het
Snx9	C	T	17: 5,908,394	T249M	probably damaging	Het
Sohlh2	C	A	3: 55,197,002	T264K	probably damaging	Het
Srrm2	A	G	17: 23,810,468		probably benign	Het
Syne2	T	A	12: 76,106,060	H6674Q	probably benign	Het
Tyw1	T	A	5: 130,335,232		probably null	Het
Vmn1r115	C	T	7: 20,844,282	R235K	probably benign	Het
Vmn2r50	A	C	7: 10,050,308	F80V	probably damaging	Het
Yme1l1	G	A	2: 23,175,187	R236H	probably damaging	Het

Other mutations in Npr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00790:Npr2	APN	4	43641612	missense	possibly damaging	0.51
IGL01116:Npr2	APN	4	43640248	missense	probably damaging	0.99
IGL01447:Npr2	APN	4	43640554	missense	possibly damaging	0.93
IGL02412:Npr2	APN	4	43647005	missense	probably damaging	0.97
IGL02449:Npr2	APN	4	43646641	missense	probably damaging	1.00
IGL03120:Npr2	APN	4	43643133	missense	probably damaging	0.99
IGL03351:Npr2	APN	4	43640652	missense	probably benign	0.36
Anterior	UTSW	4	43643622	missense	probably damaging	1.00
palmar	UTSW	4	43647553	missense	probably damaging	1.00
Plantar	UTSW	4	43640597	missense	probably damaging	1.00
Ventral	UTSW	4	43641254	missense	probably damaging	1.00
R0066:Npr2	UTSW	4	43632329	missense	probably benign	0.00
R0201:Npr2	UTSW	4	43641617	missense	probably damaging	0.98
R0309:Npr2	UTSW	4	43640904	unclassified	probably benign
R0437:Npr2	UTSW	4	43648082	missense	probably damaging	1.00
R0440:Npr2	UTSW	4	43650315	missense	probably damaging	0.99
R0464:Npr2	UTSW	4	43640597	splice site	probably null
R0511:Npr2	UTSW	4	43632801	missense	probably benign	0.00
R0576:Npr2	UTSW	4	43640947	missense	probably benign	0.01
R0630:Npr2	UTSW	4	43641219	missense	probably benign	0.18
R0690:Npr2	UTSW	4	43646991	missense	probably damaging	0.98
R1079:Npr2	UTSW	4	43643654	missense	probably damaging	1.00
R1140:Npr2	UTSW	4	43648353	missense	possibly damaging	0.87
R1171:Npr2	UTSW	4	43647260	missense	possibly damaging	0.52
R1741:Npr2	UTSW	4	43643350	missense	probably damaging	1.00
R1848:Npr2	UTSW	4	43632384	missense	probably benign
R1864:Npr2	UTSW	4	43641258	missense	probably benign	0.30
R1919:Npr2	UTSW	4	43640578	missense	probably damaging	1.00
R2054:Npr2	UTSW	4	43646560	missense	probably damaging	0.99
R2106:Npr2	UTSW	4	43644329	missense	probably damaging	1.00
R2143:Npr2	UTSW	4	43648166	missense	probably damaging	1.00
R2306:Npr2	UTSW	4	43633609	missense	probably damaging	1.00
R2372:Npr2	UTSW	4	43650432	missense	probably damaging	1.00
R2889:Npr2	UTSW	4	43641600	missense	probably benign	0.26
R3076:Npr2	UTSW	4	43640182	missense	probably damaging	1.00
R3078:Npr2	UTSW	4	43640182	missense	probably damaging	1.00
R3711:Npr2	UTSW	4	43643378	missense	probably benign	0.00
R3730:Npr2	UTSW	4	43640999	missense	possibly damaging	0.93
R4301:Npr2	UTSW	4	43641332	critical splice donor site	probably null
R4352:Npr2	UTSW	4	43646592	missense	probably damaging	1.00
R4583:Npr2	UTSW	4	43633522	splice site	probably null
R4593:Npr2	UTSW	4	43647323	unclassified	probably benign
R5042:Npr2	UTSW	4	43647002	missense	probably damaging	1.00
R5213:Npr2	UTSW	4	43640673	critical splice donor site	probably null
R5546:Npr2	UTSW	4	43650150	missense	probably damaging	1.00
R5784:Npr2	UTSW	4	43632801	missense	probably benign	0.00
R5787:Npr2	UTSW	4	43633593	missense	possibly damaging	0.69
R6364:Npr2	UTSW	4	43643622	missense	probably damaging	1.00
R6925:Npr2	UTSW	4	43647553	missense	probably damaging	1.00
R6949:Npr2	UTSW	4	43640597	missense	probably damaging	1.00
R7380:Npr2	UTSW	4	43641254	missense	probably damaging	1.00
R7432:Npr2	UTSW	4	43647155	missense	probably damaging	0.96
R7500:Npr2	UTSW	4	43650415	missense	probably damaging	1.00
R8235:Npr2	UTSW	4	43641603	missense	probably benign	0.09
R8292:Npr2	UTSW	4	43643086	missense	possibly damaging	0.70
R9310:Npr2	UTSW	4	43632404	missense	probably benign	0.01
R9684:Npr2	UTSW	4	43632491	missense	probably damaging	1.00
R9746:Npr2	UTSW	4	43633527	missense	possibly damaging	0.64
Z1176:Npr2	UTSW	4	43650720	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATTGCTCACAGTGGTATTTCTG -3'
(R):5'- CCAGTCCAAATTGATGCTGTC -3'

Sequencing Primer
(F):5'- ACTTACTATGTAGACCAGGCTGGC -3'
(R):5'- CAGTCCAAATTGATGCTGTCATTTTC -3'

Posted On

2015-07-07