Incidental Mutation 'R4467:Cds2'
ID329217
Institutional Source Beutler Lab
Gene Symbol Cds2
Ensembl Gene ENSMUSG00000058793
Gene NameCDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2
Synonyms5730460C18Rik, 5730450N06Rik, D2Wsu127e
MMRRC Submission 041724-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4467 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location132263148-132312050 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 132294446 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 39 (Y39*)
Ref Sequence ENSEMBL: ENSMUSP00000135497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089461] [ENSMUST00000103181] [ENSMUST00000110158] [ENSMUST00000125060] [ENSMUST00000147456]
Predicted Effect probably damaging
Transcript: ENSMUST00000089461
AA Change: I68N

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000086886
Gene: ENSMUSG00000058793
AA Change: I68N

DomainStartEndE-ValueType
Pfam:CTP_transf_1 52 382 5e-90 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000103181
AA Change: I85N

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099470
Gene: ENSMUSG00000058793
AA Change: I85N

DomainStartEndE-ValueType
Pfam:CTP_transf_1 69 399 7.6e-90 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110158
AA Change: I85N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105786
Gene: ENSMUSG00000058793
AA Change: I85N

DomainStartEndE-ValueType
Pfam:CTP_transf_1 69 129 3.4e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000125060
AA Change: I8N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably null
Transcript: ENSMUST00000147456
AA Change: Y39*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Breakdown products of phosphoinositides are ubiquitous second messengers that function downstream of many G protein-coupled receptors and tyrosine kinases regulating cell growth, calcium metabolism, and protein kinase C activity. This gene encodes an enzyme which regulates the amount of phosphatidylinositol available for signaling by catalyzing the conversion of phosphatidic acid to CDP-diacylglycerol. This enzyme is an integral membrane protein localized to two subcellular domains, the matrix side of the inner mitochondrial membrane where it is thought to be involved in the synthesis of phosphatidylglycerol and cardiolipin and the cytoplasmic side of the endoplasmic reticulum where it functions in phosphatidylinositol biosynthesis. Two genes encoding this enzyme have been identified in humans, one mapping to human chromosome 4q21 and a second to 20p13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a lethal phenotype. Heterozygotes show a distorted lymphocyte distribution and enhanced sensorimotor gating. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
4930402H24Rik A G 2: 130,767,647 I372T probably damaging Het
Atg4a-ps A G 3: 103,645,855 Y57H probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bms1 G A 6: 118,383,847 T1220I probably damaging Het
Brat1 T C 5: 140,705,071 probably benign Het
Casc1 A T 6: 145,183,218 probably null Het
Chrnd T A 1: 87,197,377 L384Q probably damaging Het
Cpa3 A T 3: 20,228,817 Y155* probably null Het
Crlf1 G A 8: 70,500,956 W260* probably null Het
Cux1 C G 5: 136,312,722 E605D probably damaging Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Dmtf1 T C 5: 9,136,085 N167S probably damaging Het
Dtx2 T A 5: 136,012,076 W112R probably damaging Het
Elf3 A G 1: 135,256,844 I138T probably damaging Het
F11 T A 8: 45,241,474 I617F probably damaging Het
Fdps A T 3: 89,100,786 D8E possibly damaging Het
Fzd10 C A 5: 128,601,276 T20K probably benign Het
Gm9978 T A 10: 78,486,916 noncoding transcript Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Has1 C T 17: 17,843,995 V461M probably benign Het
Hdac3 C T 18: 37,952,513 G80D probably benign Het
Klk12 A T 7: 43,773,383 R245W probably damaging Het
Lamp5 A G 2: 136,059,020 I47V probably damaging Het
Olfr786 T C 10: 129,437,064 I84T probably benign Het
Ovgp1 A G 3: 105,977,711 D122G probably benign Het
Piezo1 T C 8: 122,486,396 E1875G probably benign Het
Pih1d1 A G 7: 45,158,497 M132V possibly damaging Het
Pon2 C T 6: 5,267,021 A241T probably benign Het
Prkce A G 17: 86,619,911 I538V possibly damaging Het
Rab36 C T 10: 75,052,043 R249* probably null Het
Rps6kl1 C T 12: 85,147,808 A110T probably damaging Het
Rsad1 T C 11: 94,544,530 T244A probably benign Het
Slc22a7 T C 17: 46,432,510 I532V probably benign Het
Slc2a7 T C 4: 150,163,274 V377A possibly damaging Het
Slx4 A G 16: 3,989,055 V508A possibly damaging Het
Stag2 A G X: 42,233,872 S400G probably benign Het
Stat6 T G 10: 127,651,228 I201M probably damaging Het
Stim2 T C 5: 54,116,194 probably null Het
Tbc1d9 A G 8: 83,210,478 Y63C probably damaging Het
Tctn2 T C 5: 124,620,189 noncoding transcript Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ubr5 T A 15: 38,004,336 T1282S probably damaging Het
Ufl1 A T 4: 25,254,806 I550N probably damaging Het
Uty A G Y: 1,158,372 V557A possibly damaging Het
Vmn1r54 T C 6: 90,269,271 S56P probably damaging Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Other mutations in Cds2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cds2 APN 2 132297293 missense probably damaging 1.00
IGL00434:Cds2 APN 2 132293351 missense probably damaging 0.99
IGL00771:Cds2 APN 2 132304352 splice site probably benign
IGL00984:Cds2 APN 2 132298521 missense probably benign 0.02
IGL02041:Cds2 APN 2 132294443 missense possibly damaging 0.94
sugarless UTSW 2 132298483 missense probably damaging 1.00
R0045:Cds2 UTSW 2 132305155 missense possibly damaging 0.67
R0045:Cds2 UTSW 2 132305155 missense possibly damaging 0.67
R0452:Cds2 UTSW 2 132298479 missense probably damaging 0.99
R0455:Cds2 UTSW 2 132285967 critical splice donor site probably null
R0593:Cds2 UTSW 2 132297376 unclassified probably benign
R0831:Cds2 UTSW 2 132285967 critical splice donor site probably null
R1053:Cds2 UTSW 2 132305260 missense probably damaging 1.00
R1669:Cds2 UTSW 2 132295519 splice site probably null
R1740:Cds2 UTSW 2 132302213 missense possibly damaging 0.63
R1859:Cds2 UTSW 2 132302195 missense probably damaging 1.00
R4125:Cds2 UTSW 2 132297271 missense probably benign 0.00
R4126:Cds2 UTSW 2 132297271 missense probably benign 0.00
R4128:Cds2 UTSW 2 132297271 missense probably benign 0.00
R4352:Cds2 UTSW 2 132263445 start codon destroyed probably null 0.37
R4698:Cds2 UTSW 2 132304953 missense probably damaging 0.97
R4704:Cds2 UTSW 2 132300602 nonsense probably null
R4917:Cds2 UTSW 2 132298478 missense probably damaging 0.98
R5070:Cds2 UTSW 2 132302088 nonsense probably null
R5199:Cds2 UTSW 2 132298483 missense probably damaging 1.00
R5431:Cds2 UTSW 2 132302170 missense probably benign 0.28
R5704:Cds2 UTSW 2 132293329 missense probably benign 0.01
R5858:Cds2 UTSW 2 132302113 missense probably benign 0.00
R5946:Cds2 UTSW 2 132297248 missense probably damaging 1.00
R5954:Cds2 UTSW 2 132297271 missense probably benign 0.00
R7195:Cds2 UTSW 2 132293284 missense probably benign 0.28
R7234:Cds2 UTSW 2 132304480 critical splice donor site probably null
R7413:Cds2 UTSW 2 132293315 missense probably benign 0.03
R7983:Cds2 UTSW 2 132263510 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGTGCTAGTGGCTTCTGCAC -3'
(R):5'- GGTTCTGAGAAACCTGGAGC -3'

Sequencing Primer
(F):5'- TTCTGCACCTGCTGAGTGACAG -3'
(R):5'- TTCTGAGAAACCTGGAGCTCCAAAG -3'
Posted On2015-07-21