Incidental Mutation 'R4467:Crlf1'
ID329243
Institutional Source Beutler Lab
Gene Symbol Crlf1
Ensembl Gene ENSMUSG00000007888
Gene Namecytokine receptor-like factor 1
SynonymsCLF-1, cytokine receptor like molecule 3, CRLM3
MMRRC Submission 041724-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.714) question?
Stock #R4467 (G1)
Quality Score178
Status Validated
Chromosome8
Chromosomal Location70493158-70504081 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 70500956 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 260 (W260*)
Ref Sequence ENSEMBL: ENSMUSP00000008032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008032] [ENSMUST00000075175] [ENSMUST00000132648] [ENSMUST00000136913]
Predicted Effect probably null
Transcript: ENSMUST00000008032
AA Change: W260*
SMART Domains Protein: ENSMUSP00000008032
Gene: ENSMUSG00000007888
AA Change: W260*

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:Lep_receptor_Ig 41 127 5.7e-8 PFAM
FN3 138 223 2.11e0 SMART
FN3 238 323 1.5e-5 SMART
low complexity region 345 361 N/A INTRINSIC
low complexity region 415 425 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075175
SMART Domains Protein: ENSMUSP00000074670
Gene: ENSMUSG00000058833

DomainStartEndE-ValueType
Pfam:DNA_repr_REX1B 29 128 1.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127983
SMART Domains Protein: ENSMUSP00000115614
Gene: ENSMUSG00000007888

DomainStartEndE-ValueType
Blast:FN3 2 28 2e-12 BLAST
SCOP:d1eerb2 2 46 1e-8 SMART
low complexity region 50 66 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132107
Predicted Effect probably benign
Transcript: ENSMUST00000132648
SMART Domains Protein: ENSMUSP00000119545
Gene: ENSMUSG00000007888

DomainStartEndE-ValueType
FN3 16 101 2.11e0 SMART
low complexity region 104 122 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135773
Predicted Effect probably benign
Transcript: ENSMUST00000136913
SMART Domains Protein: ENSMUSP00000120446
Gene: ENSMUSG00000058833

DomainStartEndE-ValueType
Pfam:DNA_repr_REX1B 29 128 4.2e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143598
Meta Mutation Damage Score 0.9753 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: This gene encodes a member of the cytokine type I receptor family. The encoded protein functions as a cytokine receptor subunit and may be involved in immune system regulation and fetal development. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a targeted mutation fail to suckle effectively and do not survive beyond 24 hrs after birth. Newborns exhibit reduced numbers of hematopoietic progenitor cells as well as a significant reduction in the number of motoneurons in the lumbar spinal cord and facial nucleus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
4930402H24Rik A G 2: 130,767,647 I372T probably damaging Het
Atg4a-ps A G 3: 103,645,855 Y57H probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bms1 G A 6: 118,383,847 T1220I probably damaging Het
Brat1 T C 5: 140,705,071 probably benign Het
Casc1 A T 6: 145,183,218 probably null Het
Cds2 T A 2: 132,294,446 Y39* probably null Het
Chrnd T A 1: 87,197,377 L384Q probably damaging Het
Cpa3 A T 3: 20,228,817 Y155* probably null Het
Cux1 C G 5: 136,312,722 E605D probably damaging Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Dmtf1 T C 5: 9,136,085 N167S probably damaging Het
Dtx2 T A 5: 136,012,076 W112R probably damaging Het
Elf3 A G 1: 135,256,844 I138T probably damaging Het
F11 T A 8: 45,241,474 I617F probably damaging Het
Fdps A T 3: 89,100,786 D8E possibly damaging Het
Fzd10 C A 5: 128,601,276 T20K probably benign Het
Gm9978 T A 10: 78,486,916 noncoding transcript Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Has1 C T 17: 17,843,995 V461M probably benign Het
Hdac3 C T 18: 37,952,513 G80D probably benign Het
Klk12 A T 7: 43,773,383 R245W probably damaging Het
Lamp5 A G 2: 136,059,020 I47V probably damaging Het
Olfr786 T C 10: 129,437,064 I84T probably benign Het
Ovgp1 A G 3: 105,977,711 D122G probably benign Het
Piezo1 T C 8: 122,486,396 E1875G probably benign Het
Pih1d1 A G 7: 45,158,497 M132V possibly damaging Het
Pon2 C T 6: 5,267,021 A241T probably benign Het
Prkce A G 17: 86,619,911 I538V possibly damaging Het
Rab36 C T 10: 75,052,043 R249* probably null Het
Rps6kl1 C T 12: 85,147,808 A110T probably damaging Het
Rsad1 T C 11: 94,544,530 T244A probably benign Het
Slc22a7 T C 17: 46,432,510 I532V probably benign Het
Slc2a7 T C 4: 150,163,274 V377A possibly damaging Het
Slx4 A G 16: 3,989,055 V508A possibly damaging Het
Stag2 A G X: 42,233,872 S400G probably benign Het
Stat6 T G 10: 127,651,228 I201M probably damaging Het
Stim2 T C 5: 54,116,194 probably null Het
Tbc1d9 A G 8: 83,210,478 Y63C probably damaging Het
Tctn2 T C 5: 124,620,189 noncoding transcript Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ubr5 T A 15: 38,004,336 T1282S probably damaging Het
Ufl1 A T 4: 25,254,806 I550N probably damaging Het
Uty A G Y: 1,158,372 V557A possibly damaging Het
Vmn1r54 T C 6: 90,269,271 S56P probably damaging Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Other mutations in Crlf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02878:Crlf1 APN 8 70503640 critical splice donor site probably null
R0317:Crlf1 UTSW 8 70498599 missense probably benign
R0398:Crlf1 UTSW 8 70499089 splice site probably benign
R0437:Crlf1 UTSW 8 70499514 unclassified probably null
R1191:Crlf1 UTSW 8 70498828 missense probably damaging 1.00
R1741:Crlf1 UTSW 8 70500906 missense probably damaging 0.99
R3730:Crlf1 UTSW 8 70499442 missense probably benign 0.03
R3731:Crlf1 UTSW 8 70499442 missense probably benign 0.03
R5557:Crlf1 UTSW 8 70498667 missense probably benign 0.12
R6009:Crlf1 UTSW 8 70503479 missense probably damaging 1.00
R6348:Crlf1 UTSW 8 70493340 missense probably benign
R6606:Crlf1 UTSW 8 70501174 missense probably damaging 1.00
X0062:Crlf1 UTSW 8 70498837 unclassified probably null
Predicted Primers PCR Primer
(F):5'- CAAGCAGTCCTCAGAACTGG -3'
(R):5'- TCTGGTTGCTGACGTCATC -3'

Sequencing Primer
(F):5'- AAGGATCTCTCTGAGTTCAAGGCC -3'
(R):5'- GTTGCTGACGTCATCCACCAC -3'
Posted On2015-07-21