Incidental Mutation 'R4461:Thada'
ID330174
Institutional Source Beutler Lab
Gene Symbol Thada
Ensembl Gene ENSMUSG00000024251
Gene Namethyroid adenoma associated
Synonyms
MMRRC Submission 041720-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4461 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location84190056-84466196 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84426237 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 994 (Y994C)
Ref Sequence ENSEMBL: ENSMUSP00000041701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047524]
Predicted Effect probably damaging
Transcript: ENSMUST00000047524
AA Change: Y994C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041701
Gene: ENSMUSG00000024251
AA Change: Y994C

DomainStartEndE-ValueType
SCOP:d1gw5a_ 457 926 3e-6 SMART
Pfam:DUF2428 938 1239 1.6e-93 PFAM
SCOP:d1gw5a_ 1343 1802 7e-6 SMART
Meta Mutation Damage Score 0.6986 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the target of 2p21 choromosomal aberrations in benign thyroid adenomas. Single nucleotide polymorphisms (SNPs) in this gene may be associated with type 2 diabetes and polycystic ovary syndrome. The encoded protein is likely involved in the death receptor pathway and apoptosis. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik A G 7: 127,384,745 L395P probably damaging Het
Ankrd12 T C 17: 65,985,937 probably null Het
Apex1 T C 14: 50,926,513 V165A probably damaging Het
Btbd17 C T 11: 114,793,989 D75N possibly damaging Het
Chd2 T C 7: 73,540,874 probably benign Het
Coq10a T C 10: 128,364,478 N138S possibly damaging Het
Ctbp1 A T 5: 33,251,013 Y192N probably damaging Het
Cx3cl1 A G 8: 94,780,556 *396W probably null Het
D6Ertd527e T C 6: 87,111,317 I154T unknown Het
Dao T A 5: 114,019,926 V203E probably damaging Het
Egr4 G A 6: 85,512,340 A246V probably damaging Het
Gpsm1 G A 2: 26,319,831 probably benign Het
H2-Eb2 T A 17: 34,333,523 V114E possibly damaging Het
Hpgds A G 6: 65,123,634 L120P probably damaging Het
Ikbke C T 1: 131,265,922 V464I probably benign Het
Kank2 G A 9: 21,794,745 Q326* probably null Het
Klhl26 T C 8: 70,451,544 Y538C probably damaging Het
Klkb1 A G 8: 45,273,575 S464P probably damaging Het
Kmt2a A G 9: 44,848,966 Y529H probably damaging Het
Kmt2c A G 5: 25,299,876 V3478A probably benign Het
Knl1 A C 2: 119,059,599 N44T probably benign Het
Letm2 A G 8: 25,586,699 C296R probably damaging Het
Lrrc37a A G 11: 103,464,354 probably null Het
Med20 T C 17: 47,618,917 V93A probably benign Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Muc1 A T 3: 89,231,563 D493V probably damaging Het
Nek2 C T 1: 191,822,715 P180S probably damaging Het
Nin A T 12: 70,042,585 M1352K probably benign Het
Olfr1110 T C 2: 87,135,661 H220R probably benign Het
P3h3 A T 6: 124,845,568 S547T probably benign Het
Pik3c2g C T 6: 139,841,681 probably benign Het
Pkd1l3 A G 8: 109,632,713 probably null Het
Pzp T C 6: 128,524,040 I118M probably benign Het
Rps6ka5 C A 12: 100,570,864 D536Y probably damaging Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Siglece T C 7: 43,651,505 Q462R probably benign Het
Sirt3 T C 7: 140,865,000 D295G possibly damaging Het
Snph G A 2: 151,593,847 S318L probably benign Het
Snx18 T C 13: 113,617,195 T401A probably damaging Het
Tefm A G 11: 80,138,049 probably null Het
Trmt1 A G 8: 84,699,149 N531D probably benign Het
Ttc17 A G 2: 94,366,571 V477A probably benign Het
Ubxn10 T A 4: 138,720,876 Q163L probably benign Het
Ulk4 A T 9: 121,156,884 I908N possibly damaging Het
Zscan12 C T 13: 21,366,619 S136L possibly damaging Het
Other mutations in Thada
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Thada APN 17 84444218 missense probably benign 0.01
IGL00902:Thada APN 17 84447976 missense probably damaging 1.00
IGL01634:Thada APN 17 84393358 critical splice donor site probably null
IGL01689:Thada APN 17 84446688 missense possibly damaging 0.80
IGL01693:Thada APN 17 84446644 missense probably benign
IGL01937:Thada APN 17 84222766 missense probably benign 0.00
IGL01945:Thada APN 17 84222766 missense probably benign 0.00
IGL02231:Thada APN 17 84428697 missense probably damaging 1.00
IGL02951:Thada APN 17 84444028 missense probably benign 0.16
IGL03167:Thada APN 17 84458849 missense probably damaging 0.97
IGL03279:Thada APN 17 84435560 missense probably benign 0.01
IGL03347:Thada APN 17 84398205 missense probably damaging 1.00
H8562:Thada UTSW 17 84446544 missense probably damaging 1.00
IGL03098:Thada UTSW 17 84334141 missense possibly damaging 0.93
R0006:Thada UTSW 17 84226040 missense probably benign 0.00
R0052:Thada UTSW 17 84455158 missense probably damaging 0.99
R0052:Thada UTSW 17 84455158 missense probably damaging 0.99
R0357:Thada UTSW 17 84230936 missense probably damaging 1.00
R0388:Thada UTSW 17 84231096 missense probably benign 0.00
R0543:Thada UTSW 17 84423163 missense probably damaging 1.00
R0606:Thada UTSW 17 84416303 missense possibly damaging 0.90
R0630:Thada UTSW 17 84229175 missense probably damaging 1.00
R0664:Thada UTSW 17 84336829 missense probably damaging 1.00
R0855:Thada UTSW 17 84436655 missense probably damaging 1.00
R0972:Thada UTSW 17 84429062 splice site probably benign
R1297:Thada UTSW 17 84252435 splice site probably benign
R1465:Thada UTSW 17 84436676 missense possibly damaging 0.92
R1465:Thada UTSW 17 84436676 missense possibly damaging 0.92
R1490:Thada UTSW 17 84446601 missense possibly damaging 0.68
R1789:Thada UTSW 17 84448033 missense probably damaging 1.00
R1789:Thada UTSW 17 84448034 missense probably damaging 1.00
R1802:Thada UTSW 17 84464407 missense probably benign 0.34
R1831:Thada UTSW 17 84231114 missense probably damaging 0.97
R1834:Thada UTSW 17 84226004 missense possibly damaging 0.53
R1881:Thada UTSW 17 84436702 missense probably benign 0.19
R1925:Thada UTSW 17 84444499 missense probably benign 0.05
R1969:Thada UTSW 17 84310042 missense probably damaging 1.00
R1970:Thada UTSW 17 84310042 missense probably damaging 1.00
R1971:Thada UTSW 17 84310042 missense probably damaging 1.00
R2149:Thada UTSW 17 84441764 missense probably damaging 1.00
R2191:Thada UTSW 17 84446521 missense probably benign 0.00
R2571:Thada UTSW 17 84454640 missense probably damaging 0.99
R3405:Thada UTSW 17 84230785 splice site probably benign
R3406:Thada UTSW 17 84230785 splice site probably benign
R3916:Thada UTSW 17 84441782 missense possibly damaging 0.92
R4044:Thada UTSW 17 84441707 missense probably benign 0.41
R4662:Thada UTSW 17 84435650 missense probably damaging 1.00
R4696:Thada UTSW 17 84426186 missense possibly damaging 0.83
R4786:Thada UTSW 17 84458855 missense possibly damaging 0.66
R4803:Thada UTSW 17 84272817 missense probably damaging 0.96
R4835:Thada UTSW 17 84441104 splice site probably null
R4872:Thada UTSW 17 84446599 missense probably damaging 1.00
R4898:Thada UTSW 17 84448042 splice site probably null
R4903:Thada UTSW 17 84252400 missense possibly damaging 0.67
R4929:Thada UTSW 17 84444226 missense probably benign 0.01
R4959:Thada UTSW 17 84444183 missense probably damaging 1.00
R5071:Thada UTSW 17 84386532 missense probably damaging 1.00
R5092:Thada UTSW 17 84444468 missense probably damaging 0.97
R5398:Thada UTSW 17 84426186 missense probably benign 0.03
R5480:Thada UTSW 17 84432254 missense probably benign 0.00
R5552:Thada UTSW 17 84429130 missense probably benign 0.03
R5575:Thada UTSW 17 84416399 splice site probably null
R5623:Thada UTSW 17 84191983 missense probably benign 0.00
R5688:Thada UTSW 17 84451727 missense probably benign 0.00
R5704:Thada UTSW 17 84230901 missense probably benign 0.01
R6008:Thada UTSW 17 84436634 missense probably damaging 1.00
R6013:Thada UTSW 17 84272800 missense probably benign 0.00
R6072:Thada UTSW 17 84192006 missense possibly damaging 0.93
R6156:Thada UTSW 17 84393367 missense probably damaging 0.98
R6243:Thada UTSW 17 84436602 missense probably benign 0.01
R6449:Thada UTSW 17 84429173 missense probably benign
R6453:Thada UTSW 17 84416323 missense probably damaging 1.00
R6474:Thada UTSW 17 84443911 missense possibly damaging 0.83
R6732:Thada UTSW 17 84454414 intron probably null
R6907:Thada UTSW 17 84393469 missense probably damaging 1.00
R7117:Thada UTSW 17 84230786 splice site probably null
R7167:Thada UTSW 17 84230963 missense probably benign
R7221:Thada UTSW 17 84464366 missense possibly damaging 0.46
R7470:Thada UTSW 17 84226041 missense probably benign
R7753:Thada UTSW 17 84252390 missense probably damaging 1.00
R7809:Thada UTSW 17 84451837 missense possibly damaging 0.80
R7882:Thada UTSW 17 84429196 missense possibly damaging 0.85
R7965:Thada UTSW 17 84429196 missense possibly damaging 0.85
R8004:Thada UTSW 17 84192205 missense probably benign
Z1176:Thada UTSW 17 84444430 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGGTATAGGCTCATCAGTACAACC -3'
(R):5'- TGGGTATAGCTGACTGTCACTG -3'

Sequencing Primer
(F):5'- GGCTCATCAGTACAACCCTACATAG -3'
(R):5'- GACTGTCACTGTTAAAAATCATGGC -3'
Posted On2015-07-21