Incidental Mutation 'R4489:4930430A15Rik'
ID 330620
Institutional Source Beutler Lab
Gene Symbol 4930430A15Rik
Ensembl Gene ENSMUSG00000027157
Gene Name RIKEN cDNA 4930430A15 gene
Synonyms
MMRRC Submission 041745-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # R4489 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 111162061-111229602 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 111220702 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 250 (Y250H)
Ref Sequence ENSEMBL: ENSMUSP00000028577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028577]
AlphaFold Q05AC5
Predicted Effect probably benign
Transcript: ENSMUST00000028577
AA Change: Y250H

PolyPhen 2 Score 0.309 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000028577
Gene: ENSMUSG00000027157
AA Change: Y250H

DomainStartEndE-ValueType
ANK 78 107 1.61e-4 SMART
ANK 111 140 3.6e-2 SMART
ANK 144 173 4.89e-4 SMART
ANK 177 206 4.03e-5 SMART
ANK 210 239 8.72e-1 SMART
Blast:ANK 243 272 4e-12 BLAST
low complexity region 460 472 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 94% (50/53)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 37,003,933 Q3224L probably null Het
Abcd2 A G 15: 91,178,283 V484A probably damaging Het
Ank3 C T 10: 69,898,256 A754V probably damaging Het
Ano1 T C 7: 144,611,742 N582S probably benign Het
Arnt2 T A 7: 84,275,345 T425S probably benign Het
Cand2 A G 6: 115,789,466 D344G probably damaging Het
Clta T G 4: 44,032,417 F198V probably damaging Het
Cnga2 T A X: 72,006,127 F133I possibly damaging Het
Csmd2 G A 4: 128,381,945 V826M possibly damaging Het
Dnah11 C T 12: 117,916,896 V3830I probably benign Het
Fhl4 T C 10: 85,098,455 D154G possibly damaging Het
Gbp4 T A 5: 105,121,907 T352S probably damaging Het
Gigyf2 A G 1: 87,440,826 D1076G probably damaging Het
Gm21370 T A 13: 120,026,842 Y57F probably benign Het
Gm6489 A G 1: 31,287,239 noncoding transcript Het
Grm6 T C 11: 50,859,989 S660P probably damaging Het
Hectd4 T G 5: 121,286,257 I660R possibly damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Htr1b A T 9: 81,631,539 D338E probably benign Het
Kif1bp A G 10: 62,563,027 probably benign Het
Lrp1b T C 2: 40,661,489 probably benign Het
Lzts1 T A 8: 69,135,695 K536N possibly damaging Het
Mrpl22 T A 11: 58,173,102 N49K probably benign Het
Mzt1 T C 14: 99,036,490 *42W probably null Het
Nkx3-2 T G 5: 41,761,961 Q228P probably damaging Het
Nufip2 T G 11: 77,686,229 M1R probably null Het
Obscn G A 11: 59,031,591 T5921M possibly damaging Het
Olfr1221 T C 2: 89,111,572 probably null Het
Olfr676 T C 7: 105,035,303 F35S probably benign Het
Pcdha11 C A 18: 37,006,916 Q533K possibly damaging Het
Pgm5 T C 19: 24,816,445 E285G probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rgs21 T C 1: 144,519,875 T92A possibly damaging Het
Rgsl1 T A 1: 153,827,536 Y123F probably benign Het
Rnf13 A C 3: 57,820,589 K230T probably damaging Het
Sgf29 T C 7: 126,663,938 S29P possibly damaging Het
Smchd1 T C 17: 71,407,235 T878A probably benign Het
Specc1 T G 11: 62,151,827 probably null Het
Tg A T 15: 66,707,942 Q1532L probably damaging Het
Timm44 A C 8: 4,266,654 S297A possibly damaging Het
Txndc9 G T 1: 37,995,790 S11* probably null Het
Uggt1 C T 1: 36,146,668 W1478* probably null Het
Washc3 T C 10: 88,216,031 V87A probably benign Het
Xlr5b T C X: 73,157,898 probably null Het
Other mutations in 4930430A15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:4930430A15Rik APN 2 111220762 missense probably damaging 0.98
IGL01403:4930430A15Rik APN 2 111229170 unclassified probably benign
IGL01431:4930430A15Rik APN 2 111225395 unclassified probably benign
IGL01601:4930430A15Rik APN 2 111193478 missense unknown
IGL01649:4930430A15Rik APN 2 111214576 splice site probably benign
IGL02355:4930430A15Rik APN 2 111211651 splice site probably benign
IGL02362:4930430A15Rik APN 2 111211651 splice site probably benign
IGL02485:4930430A15Rik APN 2 111228325 missense probably damaging 0.97
IGL02620:4930430A15Rik APN 2 111211625 missense probably benign 0.00
IGL03156:4930430A15Rik APN 2 111200412 missense possibly damaging 0.90
IGL02980:4930430A15Rik UTSW 2 111164473 missense unknown
R0577:4930430A15Rik UTSW 2 111194349 missense probably benign 0.27
R0638:4930430A15Rik UTSW 2 111200418 missense probably damaging 0.96
R0645:4930430A15Rik UTSW 2 111214583 critical splice donor site probably null
R0671:4930430A15Rik UTSW 2 111204137 missense possibly damaging 0.93
R0829:4930430A15Rik UTSW 2 111198105 missense possibly damaging 0.92
R1464:4930430A15Rik UTSW 2 111225403 critical splice donor site probably null
R1464:4930430A15Rik UTSW 2 111225403 critical splice donor site probably null
R1486:4930430A15Rik UTSW 2 111200358 missense possibly damaging 0.84
R1509:4930430A15Rik UTSW 2 111218627 missense probably benign
R1672:4930430A15Rik UTSW 2 111220774 missense probably benign 0.00
R2073:4930430A15Rik UTSW 2 111200418 missense probably damaging 0.96
R2074:4930430A15Rik UTSW 2 111200418 missense probably damaging 0.96
R2075:4930430A15Rik UTSW 2 111200418 missense probably damaging 0.96
R2899:4930430A15Rik UTSW 2 111220670 splice site probably benign
R2965:4930430A15Rik UTSW 2 111204019 missense possibly damaging 0.61
R3110:4930430A15Rik UTSW 2 111228054 missense probably damaging 1.00
R3112:4930430A15Rik UTSW 2 111228054 missense probably damaging 1.00
R4821:4930430A15Rik UTSW 2 111204145 critical splice acceptor site probably null
R4925:4930430A15Rik UTSW 2 111218616 missense probably benign 0.41
R5045:4930430A15Rik UTSW 2 111193459 missense unknown
R5057:4930430A15Rik UTSW 2 111225421 missense probably benign 0.12
R5128:4930430A15Rik UTSW 2 111164329 nonsense probably null
R5250:4930430A15Rik UTSW 2 111228077 missense possibly damaging 0.87
R5333:4930430A15Rik UTSW 2 111194337 missense possibly damaging 0.92
R5376:4930430A15Rik UTSW 2 111215599 missense probably benign 0.44
R5677:4930430A15Rik UTSW 2 111211565 missense probably benign
R5722:4930430A15Rik UTSW 2 111204123 missense probably benign
R5735:4930430A15Rik UTSW 2 111225492 nonsense probably null
R6170:4930430A15Rik UTSW 2 111227948 missense probably benign 0.03
R6366:4930430A15Rik UTSW 2 111169592 critical splice donor site probably null
R6496:4930430A15Rik UTSW 2 111164472 missense unknown
R6654:4930430A15Rik UTSW 2 111171884 missense unknown
R6983:4930430A15Rik UTSW 2 111228250 critical splice donor site probably null
R7371:4930430A15Rik UTSW 2 111193481 missense unknown
R7958:4930430A15Rik UTSW 2 111170325 missense unknown
R8421:4930430A15Rik UTSW 2 111218610 nonsense probably null
R8495:4930430A15Rik UTSW 2 111229410 start codon destroyed probably null 0.33
R8534:4930430A15Rik UTSW 2 111228035 missense possibly damaging 0.92
R8671:4930430A15Rik UTSW 2 111229532 unclassified probably benign
R8679:4930430A15Rik UTSW 2 111229222 missense possibly damaging 0.73
R8743:4930430A15Rik UTSW 2 111169672 missense unknown
R8983:4930430A15Rik UTSW 2 111200356 missense probably benign 0.00
R9213:4930430A15Rik UTSW 2 111190354 missense unknown
R9457:4930430A15Rik UTSW 2 111170286 missense unknown
Predicted Primers PCR Primer
(F):5'- AGGTACTTGGTTCAATCTTCAGC -3'
(R):5'- TACAGAAGGCTTCCTACCCATTC -3'

Sequencing Primer
(F):5'- GGTTCAATCTTCAGCATTTCCAAATC -3'
(R):5'- AATGAACTCTTGCTTACCATAGTG -3'
Posted On 2015-07-21