Mutagenetix > Incidental Mutation

Incidental Mutation 'R4489:4930430A15Rik'

330620

Institutional Source

Beutler Lab

Gene Symbol

4930430A15Rik

Ensembl Gene

ENSMUSG00000027157

Gene Name

RIKEN cDNA 4930430A15 gene

Synonyms

MMRRC Submission

041745-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.056) question?

Stock #

R4489 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

111162061-111229602 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 111220702 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 250 (Y250H)

Ref Sequence

ENSEMBL: ENSMUSP00000028577 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028577]

AlphaFold

Q05AC5

Predicted Effect

probably benign
Transcript: ENSMUST00000028577
AA Change: Y250H

PolyPhen 2 Score 0.309 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000028577
Gene: ENSMUSG00000027157
AA Change: Y250H

Domain	Start	End	E-Value	Type
ANK	78	107	1.61e-4	SMART
ANK	111	140	3.6e-2	SMART
ANK	144	173	4.89e-4	SMART
ANK	177	206	4.03e-5	SMART
ANK	210	239	8.72e-1	SMART
Blast:ANK	243	272	4e-12	BLAST
low complexity region	460	472	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

94% (50/53)

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	A	T	3: 37,003,933	Q3224L	probably null	Het
Abcd2	A	G	15: 91,178,283	V484A	probably damaging	Het
Ank3	C	T	10: 69,898,256	A754V	probably damaging	Het
Ano1	T	C	7: 144,611,742	N582S	probably benign	Het
Arnt2	T	A	7: 84,275,345	T425S	probably benign	Het
Cand2	A	G	6: 115,789,466	D344G	probably damaging	Het
Clta	T	G	4: 44,032,417	F198V	probably damaging	Het
Cnga2	T	A	X: 72,006,127	F133I	possibly damaging	Het
Csmd2	G	A	4: 128,381,945	V826M	possibly damaging	Het
Dnah11	C	T	12: 117,916,896	V3830I	probably benign	Het
Fhl4	T	C	10: 85,098,455	D154G	possibly damaging	Het
Gbp4	T	A	5: 105,121,907	T352S	probably damaging	Het
Gigyf2	A	G	1: 87,440,826	D1076G	probably damaging	Het
Gm21370	T	A	13: 120,026,842	Y57F	probably benign	Het
Gm6489	A	G	1: 31,287,239		noncoding transcript	Het
Grm6	T	C	11: 50,859,989	S660P	probably damaging	Het
Hectd4	T	G	5: 121,286,257	I660R	possibly damaging	Het
Homer3	G	A	8: 70,290,143		probably null	Het
Htr1b	A	T	9: 81,631,539	D338E	probably benign	Het
Kif1bp	A	G	10: 62,563,027		probably benign	Het
Lrp1b	T	C	2: 40,661,489		probably benign	Het
Lzts1	T	A	8: 69,135,695	K536N	possibly damaging	Het
Mrpl22	T	A	11: 58,173,102	N49K	probably benign	Het
Mzt1	T	C	14: 99,036,490	*42W	probably null	Het
Nkx3-2	T	G	5: 41,761,961	Q228P	probably damaging	Het
Nufip2	T	G	11: 77,686,229	M1R	probably null	Het
Obscn	G	A	11: 59,031,591	T5921M	possibly damaging	Het
Olfr1221	T	C	2: 89,111,572		probably null	Het
Olfr676	T	C	7: 105,035,303	F35S	probably benign	Het
Pcdha11	C	A	18: 37,006,916	Q533K	possibly damaging	Het
Pgm5	T	C	19: 24,816,445	E285G	probably benign	Het
Plxna2	C	T	1: 194,749,317	S538F	probably damaging	Het
Rgs21	T	C	1: 144,519,875	T92A	possibly damaging	Het
Rgsl1	T	A	1: 153,827,536	Y123F	probably benign	Het
Rnf13	A	C	3: 57,820,589	K230T	probably damaging	Het
Sgf29	T	C	7: 126,663,938	S29P	possibly damaging	Het
Smchd1	T	C	17: 71,407,235	T878A	probably benign	Het
Specc1	T	G	11: 62,151,827		probably null	Het
Tg	A	T	15: 66,707,942	Q1532L	probably damaging	Het
Timm44	A	C	8: 4,266,654	S297A	possibly damaging	Het
Txndc9	G	T	1: 37,995,790	S11*	probably null	Het
Uggt1	C	T	1: 36,146,668	W1478*	probably null	Het
Washc3	T	C	10: 88,216,031	V87A	probably benign	Het
Xlr5b	T	C	X: 73,157,898		probably null	Het

Other mutations in 4930430A15Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:4930430A15Rik	APN	2	111220762	missense	probably damaging	0.98
IGL01403:4930430A15Rik	APN	2	111229170	unclassified	probably benign
IGL01431:4930430A15Rik	APN	2	111225395	unclassified	probably benign
IGL01601:4930430A15Rik	APN	2	111193478	missense	unknown
IGL01649:4930430A15Rik	APN	2	111214576	splice site	probably benign
IGL02355:4930430A15Rik	APN	2	111211651	splice site	probably benign
IGL02362:4930430A15Rik	APN	2	111211651	splice site	probably benign
IGL02485:4930430A15Rik	APN	2	111228325	missense	probably damaging	0.97
IGL02620:4930430A15Rik	APN	2	111211625	missense	probably benign	0.00
IGL03156:4930430A15Rik	APN	2	111200412	missense	possibly damaging	0.90
IGL02980:4930430A15Rik	UTSW	2	111164473	missense	unknown
R0577:4930430A15Rik	UTSW	2	111194349	missense	probably benign	0.27
R0638:4930430A15Rik	UTSW	2	111200418	missense	probably damaging	0.96
R0645:4930430A15Rik	UTSW	2	111214583	critical splice donor site	probably null
R0671:4930430A15Rik	UTSW	2	111204137	missense	possibly damaging	0.93
R0829:4930430A15Rik	UTSW	2	111198105	missense	possibly damaging	0.92
R1464:4930430A15Rik	UTSW	2	111225403	critical splice donor site	probably null
R1464:4930430A15Rik	UTSW	2	111225403	critical splice donor site	probably null
R1486:4930430A15Rik	UTSW	2	111200358	missense	possibly damaging	0.84
R1509:4930430A15Rik	UTSW	2	111218627	missense	probably benign
R1672:4930430A15Rik	UTSW	2	111220774	missense	probably benign	0.00
R2073:4930430A15Rik	UTSW	2	111200418	missense	probably damaging	0.96
R2074:4930430A15Rik	UTSW	2	111200418	missense	probably damaging	0.96
R2075:4930430A15Rik	UTSW	2	111200418	missense	probably damaging	0.96
R2899:4930430A15Rik	UTSW	2	111220670	splice site	probably benign
R2965:4930430A15Rik	UTSW	2	111204019	missense	possibly damaging	0.61
R3110:4930430A15Rik	UTSW	2	111228054	missense	probably damaging	1.00
R3112:4930430A15Rik	UTSW	2	111228054	missense	probably damaging	1.00
R4821:4930430A15Rik	UTSW	2	111204145	critical splice acceptor site	probably null
R4925:4930430A15Rik	UTSW	2	111218616	missense	probably benign	0.41
R5045:4930430A15Rik	UTSW	2	111193459	missense	unknown
R5057:4930430A15Rik	UTSW	2	111225421	missense	probably benign	0.12
R5128:4930430A15Rik	UTSW	2	111164329	nonsense	probably null
R5250:4930430A15Rik	UTSW	2	111228077	missense	possibly damaging	0.87
R5333:4930430A15Rik	UTSW	2	111194337	missense	possibly damaging	0.92
R5376:4930430A15Rik	UTSW	2	111215599	missense	probably benign	0.44
R5677:4930430A15Rik	UTSW	2	111211565	missense	probably benign
R5722:4930430A15Rik	UTSW	2	111204123	missense	probably benign
R5735:4930430A15Rik	UTSW	2	111225492	nonsense	probably null
R6170:4930430A15Rik	UTSW	2	111227948	missense	probably benign	0.03
R6366:4930430A15Rik	UTSW	2	111169592	critical splice donor site	probably null
R6496:4930430A15Rik	UTSW	2	111164472	missense	unknown
R6654:4930430A15Rik	UTSW	2	111171884	missense	unknown
R6983:4930430A15Rik	UTSW	2	111228250	critical splice donor site	probably null
R7371:4930430A15Rik	UTSW	2	111193481	missense	unknown
R7958:4930430A15Rik	UTSW	2	111170325	missense	unknown
R8421:4930430A15Rik	UTSW	2	111218610	nonsense	probably null
R8495:4930430A15Rik	UTSW	2	111229410	start codon destroyed	probably null	0.33
R8534:4930430A15Rik	UTSW	2	111228035	missense	possibly damaging	0.92
R8671:4930430A15Rik	UTSW	2	111229532	unclassified	probably benign
R8679:4930430A15Rik	UTSW	2	111229222	missense	possibly damaging	0.73
R8743:4930430A15Rik	UTSW	2	111169672	missense	unknown
R8983:4930430A15Rik	UTSW	2	111200356	missense	probably benign	0.00
R9213:4930430A15Rik	UTSW	2	111190354	missense	unknown
R9457:4930430A15Rik	UTSW	2	111170286	missense	unknown
R9723:4930430A15Rik	UTSW	2	111228355	missense	probably damaging	0.97
R9745:4930430A15Rik	UTSW	2	111169663	missense	unknown

Predicted Primers

PCR Primer
(F):5'- AGGTACTTGGTTCAATCTTCAGC -3'
(R):5'- TACAGAAGGCTTCCTACCCATTC -3'

Sequencing Primer
(F):5'- GGTTCAATCTTCAGCATTTCCAAATC -3'
(R):5'- AATGAACTCTTGCTTACCATAGTG -3'

Posted On

2015-07-21