Incidental Mutation 'R0207:Cfap70'
ID33421
Institutional Source Beutler Lab
Gene Symbol Cfap70
Ensembl Gene ENSMUSG00000039543
Gene Namecilia and flagella associated protein 70
Synonyms5330402L21Rik, Ttc18
MMRRC Submission 038460-MU
Accession Numbers

NCBI RefSeq: NM_001163638.1, NM_001163639.1, NM_029698.1; MGI: 1923920

Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R0207 (G1)
Quality Score209
Status Validated
Chromosome14
Chromosomal Location20394193-20452226 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 20412347 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 659 (E659D)
Ref Sequence ENSEMBL: ENSMUSP00000056869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022348] [ENSMUST00000022349] [ENSMUST00000056073]
Predicted Effect probably damaging
Transcript: ENSMUST00000022348
AA Change: E615D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022348
Gene: ENSMUSG00000039543
AA Change: E615D

DomainStartEndE-ValueType
Blast:C2 11 122 5e-44 BLAST
low complexity region 494 503 N/A INTRINSIC
low complexity region 581 590 N/A INTRINSIC
Blast:TPR 591 623 2e-11 BLAST
Blast:TPR 624 657 3e-15 BLAST
TPR 658 691 1.73e1 SMART
Blast:TPR 693 724 2e-7 BLAST
TPR 905 938 1.26e1 SMART
TPR 939 972 5.03e-1 SMART
TPR 976 1009 2.52e-1 SMART
TPR 1043 1076 2.07e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000022349
AA Change: E603D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022349
Gene: ENSMUSG00000039543
AA Change: E603D

DomainStartEndE-ValueType
Blast:C2 11 122 5e-44 BLAST
low complexity region 438 447 N/A INTRINSIC
low complexity region 569 578 N/A INTRINSIC
Blast:TPR 579 611 2e-11 BLAST
Blast:TPR 612 645 3e-15 BLAST
TPR 646 679 1.73e1 SMART
Blast:TPR 681 712 2e-7 BLAST
TPR 932 965 1.26e1 SMART
TPR 966 999 5.03e-1 SMART
TPR 1003 1036 2.52e-1 SMART
TPR 1070 1103 2.07e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000056073
AA Change: E659D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056869
Gene: ENSMUSG00000039543
AA Change: E659D

DomainStartEndE-ValueType
Blast:C2 11 122 5e-44 BLAST
low complexity region 494 503 N/A INTRINSIC
low complexity region 625 634 N/A INTRINSIC
Blast:TPR 635 667 2e-11 BLAST
Blast:TPR 668 701 3e-15 BLAST
TPR 702 735 1.73e1 SMART
Blast:TPR 737 768 2e-7 BLAST
TPR 949 982 1.26e1 SMART
TPR 983 1016 5.03e-1 SMART
TPR 1020 1053 2.52e-1 SMART
TPR 1087 1120 2.07e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000144797
AA Change: E664D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116668
Gene: ENSMUSG00000039543
AA Change: E664D

DomainStartEndE-ValueType
Blast:C2 11 122 5e-44 BLAST
low complexity region 494 503 N/A INTRINSIC
low complexity region 630 639 N/A INTRINSIC
Blast:TPR 640 672 2e-11 BLAST
Blast:TPR 673 706 3e-15 BLAST
TPR 707 740 1.73e1 SMART
Blast:TPR 742 773 2e-7 BLAST
TPR 954 987 1.26e1 SMART
TPR 988 1021 5.03e-1 SMART
TPR 1025 1058 2.52e-1 SMART
TPR 1092 1125 2.07e1 SMART
Meta Mutation Damage Score 0.1572 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.5%
Validation Efficiency 95% (76/80)
Allele List at MGI

All alleles(17) : Targeted(2) Gene trapped(15)

Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,086,039 F488S probably damaging Het
Acap3 C T 4: 155,899,424 R116W probably damaging Het
Adamts10 C A 17: 33,545,390 P663T possibly damaging Het
Akap12 G A 10: 4,353,333 G48S probably damaging Het
Ankrd7 T A 6: 18,870,031 M261K probably benign Het
Ankzf1 C A 1: 75,198,304 D599E possibly damaging Het
Aox1 T C 1: 58,105,014 I1278T possibly damaging Het
Apcdd1 T C 18: 62,950,079 Y327H probably benign Het
Asxl3 T A 18: 22,411,496 probably benign Het
Birc6 C A 17: 74,662,832 probably benign Het
Btaf1 T A 19: 37,009,648 L1714* probably null Het
Cacng6 T A 7: 3,425,004 probably benign Het
Cdc20b A G 13: 113,078,612 D238G probably damaging Het
Celf5 T A 10: 81,470,698 R113W probably null Het
Clspn T A 4: 126,590,598 M1183K possibly damaging Het
Dpy19l1 G A 9: 24,453,891 R275C probably damaging Het
Dst C T 1: 34,186,935 S1721L probably benign Het
Faap100 T C 11: 120,374,365 T562A probably damaging Het
Fam168b T C 1: 34,819,688 M133V probably damaging Het
Farp2 T C 1: 93,569,087 I172T probably damaging Het
Fer T G 17: 63,896,278 S68A probably damaging Het
Fmo5 A G 3: 97,645,681 E315G probably damaging Het
Gpr89 A T 3: 96,871,480 F426I probably damaging Het
Hinfp T C 9: 44,296,327 I461V possibly damaging Het
Hsd11b1 A T 1: 193,240,248 V167D probably damaging Het
Htt A G 5: 34,896,908 K2574E probably benign Het
I830077J02Rik A G 3: 105,926,505 S112P probably benign Het
Igf2bp3 T A 6: 49,105,617 M344L probably benign Het
Itch A T 2: 155,202,257 Q494L probably benign Het
Itga9 T C 9: 118,769,253 probably benign Het
Jaml T A 9: 45,093,767 D152E probably benign Het
Kif22 A C 7: 127,042,400 M1R probably null Het
Kifap3 T C 1: 163,883,386 Y663H probably benign Het
Letm2 T A 8: 25,578,770 N472I probably damaging Het
Mthfr T G 4: 148,052,224 V446G probably damaging Het
Myh11 T C 16: 14,211,260 E1206G possibly damaging Het
Myo6 G A 9: 80,288,056 V903I probably damaging Het
Myo9b C T 8: 71,355,225 probably benign Het
Nr2f2 G C 7: 70,360,175 P52R probably damaging Het
Nsd3 A G 8: 25,683,257 N859S probably benign Het
Nucb2 C A 7: 116,536,010 A384E probably damaging Het
Ogdhl C A 14: 32,342,037 probably null Het
Olfr119 C A 17: 37,701,058 C129* probably null Het
Olfr1247 G A 2: 89,609,863 L80F probably damaging Het
Olfr1357 T C 10: 78,611,871 T257A probably benign Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr381 A T 11: 73,486,575 L83Q probably benign Het
Parp10 C T 15: 76,242,633 S145N probably benign Het
Pigh A G 12: 79,083,709 probably benign Het
Pigo A G 4: 43,023,824 probably benign Het
Pkp4 T A 2: 59,305,488 V199D possibly damaging Het
Polr1e C A 4: 45,025,143 probably null Het
Ppfia3 C A 7: 45,348,534 R723L probably damaging Het
Prex1 C A 2: 166,585,898 A945S possibly damaging Het
Prrt3 A T 6: 113,495,840 V457E probably damaging Het
Rab39 A G 9: 53,705,971 F49L possibly damaging Het
Rrs1 C A 1: 9,545,762 probably null Het
Rrs1 G A 1: 9,545,767 E82K probably damaging Het
Serpinb3c T C 1: 107,276,992 D8G probably benign Het
Slc17a6 A G 7: 51,646,180 probably benign Het
Slc24a4 T A 12: 102,228,951 probably null Het
Smc1b C T 15: 85,123,759 M272I probably benign Het
Smc6 T C 12: 11,283,178 probably benign Het
Tcf20 T C 15: 82,855,085 T722A probably benign Het
Tesmin A T 19: 3,404,088 M141L probably benign Het
Tmprss5 T A 9: 49,113,160 H274Q possibly damaging Het
Tns1 C T 1: 73,937,318 probably null Het
Tpr T C 1: 150,417,427 S868P possibly damaging Het
Trank1 C T 9: 111,366,253 T1115I probably damaging Het
Trmt44 A T 5: 35,572,917 I203K possibly damaging Het
Ulk2 A T 11: 61,777,785 V1037E probably benign Het
Usp43 A G 11: 67,876,499 Y682H probably damaging Het
Vipr2 A T 12: 116,142,882 Q366L probably damaging Het
Vmn1r185 C A 7: 26,611,589 V164L possibly damaging Het
Vmn2r120 C T 17: 57,525,052 V246I probably benign Het
Wdr66 T C 5: 123,283,447 V182A probably damaging Het
Wiz C T 17: 32,357,033 G790R probably damaging Het
Wnk1 A T 6: 119,952,733 S1016R probably damaging Het
Zc3hav1 A G 6: 38,311,174 L909S probably benign Het
Zfp236 T A 18: 82,640,227 I637F probably damaging Het
Zfp788 G A 7: 41,649,596 G532D probably damaging Het
Zranb1 T C 7: 132,950,385 I255T probably damaging Het
Other mutations in Cfap70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Cfap70 APN 14 20412462 missense possibly damaging 0.77
IGL00567:Cfap70 APN 14 20394680 missense probably benign 0.30
IGL00773:Cfap70 APN 14 20447534 missense probably damaging 1.00
IGL01061:Cfap70 APN 14 20447625 splice site probably benign
IGL01520:Cfap70 APN 14 20420687 missense probably benign 0.23
IGL01665:Cfap70 APN 14 20403118 missense probably damaging 1.00
IGL01918:Cfap70 APN 14 20425399 missense possibly damaging 0.81
IGL02211:Cfap70 APN 14 20394972 missense probably damaging 1.00
IGL02613:Cfap70 APN 14 20409064 splice site probably null
IGL03142:Cfap70 APN 14 20397215 missense probably damaging 0.99
IGL03354:Cfap70 APN 14 20431982 missense probably damaging 1.00
IGL03047:Cfap70 UTSW 14 20448578 missense possibly damaging 0.92
IGL03097:Cfap70 UTSW 14 20448608 missense probably benign 0.00
P0008:Cfap70 UTSW 14 20416532 missense probably damaging 0.99
P0035:Cfap70 UTSW 14 20424471 splice site probably benign
R0200:Cfap70 UTSW 14 20448563 missense probably damaging 0.96
R0238:Cfap70 UTSW 14 20448605 missense probably benign 0.01
R0238:Cfap70 UTSW 14 20448605 missense probably benign 0.01
R0239:Cfap70 UTSW 14 20448605 missense probably benign 0.01
R0239:Cfap70 UTSW 14 20448605 missense probably benign 0.01
R0463:Cfap70 UTSW 14 20448563 missense probably damaging 0.96
R0608:Cfap70 UTSW 14 20448563 missense probably damaging 0.96
R0703:Cfap70 UTSW 14 20439715 missense probably damaging 1.00
R0919:Cfap70 UTSW 14 20404164 missense probably benign 0.00
R0928:Cfap70 UTSW 14 20443919 missense probably damaging 1.00
R1595:Cfap70 UTSW 14 20447536 missense probably benign 0.10
R1667:Cfap70 UTSW 14 20404157 missense probably benign 0.41
R1799:Cfap70 UTSW 14 20394999 missense probably damaging 1.00
R1869:Cfap70 UTSW 14 20408610 nonsense probably null
R1920:Cfap70 UTSW 14 20394952 missense probably damaging 1.00
R1968:Cfap70 UTSW 14 20420811 missense possibly damaging 0.93
R2173:Cfap70 UTSW 14 20408562 missense probably benign 0.00
R3081:Cfap70 UTSW 14 20420762 missense probably damaging 1.00
R3813:Cfap70 UTSW 14 20421122 missense possibly damaging 0.95
R3979:Cfap70 UTSW 14 20439719 missense probably benign 0.11
R4093:Cfap70 UTSW 14 20409113 missense probably damaging 1.00
R4271:Cfap70 UTSW 14 20420725 missense probably benign 0.00
R4604:Cfap70 UTSW 14 20443661 missense probably benign 0.01
R4839:Cfap70 UTSW 14 20425529 missense probably damaging 0.96
R6387:Cfap70 UTSW 14 20448575 missense probably damaging 1.00
R6464:Cfap70 UTSW 14 20401039 splice site probably null
R6915:Cfap70 UTSW 14 20409085 missense probably benign 0.17
R7317:Cfap70 UTSW 14 20400434 missense possibly damaging 0.78
R7400:Cfap70 UTSW 14 20408267 missense probably benign
R7962:Cfap70 UTSW 14 20436786 missense probably benign 0.00
R7974:Cfap70 UTSW 14 20420750 missense probably damaging 0.99
R7996:Cfap70 UTSW 14 20409126 missense probably benign 0.02
R8897:Cfap70 UTSW 14 20443601 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGGGAGGGAGAAAGATAAATAACAAAACCGAA -3'
(R):5'- CATGcacacacacacacacacacac -3'

Sequencing Primer
(F):5'- tcaggaggcagaggcgg -3'
(R):5'- cacacacacacacacacatac -3'
Posted On2013-05-09