Mutagenetix > Incidental Mutation

Incidental Mutation 'R0207:Itga9'

33408

Institutional Source

Beutler Lab

Gene Symbol

Itga9

Ensembl Gene

ENSMUSG00000039115

Gene Name

integrin alpha 9

Synonyms

D9Ertd428e, 2610002H11Rik, 6720458D17Rik

MMRRC Submission

038460-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0207 (G1)

Quality Score

185

Status

Validated

Chromosome

Chromosomal Location

118606690-118901003 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 118769253 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000122417 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044165] [ENSMUST00000124360]

AlphaFold

B8JK39

Predicted Effect

probably benign
Transcript: ENSMUST00000044165

SMART Domains

Protein: ENSMUSP00000044227
Gene: ENSMUSG00000039115

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Int_alpha	45	105	8.95e-7	SMART
low complexity region	181	191	N/A	INTRINSIC
Int_alpha	244	297	2.12e-8	SMART
Int_alpha	301	356	1.68e-11	SMART
Int_alpha	361	416	2.9e-15	SMART
Int_alpha	423	476	1.11e-2	SMART
SCOP:d1m1xa2	626	766	3e-32	SMART
SCOP:d1m1xa3	769	970	1e-39	SMART
transmembrane domain	981	1003	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124360

SMART Domains

Protein: ENSMUSP00000122417
Gene: ENSMUSG00000039115

Domain	Start	End	E-Value	Type
Pfam:Integrin_alpha2	1	357	2.1e-61	PFAM
transmembrane domain	395	417	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125021

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.2%
20x: 95.5%

Validation Efficiency

95% (76/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha integrin. Integrins are heterodimeric integral membrane glycoproteins composed of an alpha chain and a beta chain that mediate cell-cell and cell-matrix adhesion. The protein encoded by this gene, when bound to the beta 1 chain, forms an integrin that is a receptor for VCAM1, cytotactin and osteopontin. Expression of this gene has been found to be upregulated in small cell lung cancers. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in respiratory distress leading to postnatal lethality caused by an accumulation of pleural fluid rich in triglyceride, cholesterol and lymphocytes. Mice develop edema and lymphocytic infiltration in the chest wall. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	A	G	4: 53,086,039	F488S	probably damaging	Het
Acap3	C	T	4: 155,899,424	R116W	probably damaging	Het
Adamts10	C	A	17: 33,545,390	P663T	possibly damaging	Het
Akap12	G	A	10: 4,353,333	G48S	probably damaging	Het
Ankrd7	T	A	6: 18,870,031	M261K	probably benign	Het
Ankzf1	C	A	1: 75,198,304	D599E	possibly damaging	Het
Aox1	T	C	1: 58,105,014	I1278T	possibly damaging	Het
Apcdd1	T	C	18: 62,950,079	Y327H	probably benign	Het
Asxl3	T	A	18: 22,411,496		probably benign	Het
Birc6	C	A	17: 74,662,832		probably benign	Het
Btaf1	T	A	19: 37,009,648	L1714*	probably null	Het
Cacng6	T	A	7: 3,425,004		probably benign	Het
Cdc20b	A	G	13: 113,078,612	D238G	probably damaging	Het
Celf5	T	A	10: 81,470,698	R113W	probably null	Het
Cfap70	C	A	14: 20,412,347	E659D	probably damaging	Het
Clspn	T	A	4: 126,590,598	M1183K	possibly damaging	Het
Dpy19l1	G	A	9: 24,453,891	R275C	probably damaging	Het
Dst	C	T	1: 34,186,935	S1721L	probably benign	Het
Faap100	T	C	11: 120,374,365	T562A	probably damaging	Het
Fam168b	T	C	1: 34,819,688	M133V	probably damaging	Het
Farp2	T	C	1: 93,569,087	I172T	probably damaging	Het
Fer	T	G	17: 63,896,278	S68A	probably damaging	Het
Fmo5	A	G	3: 97,645,681	E315G	probably damaging	Het
Gpr89	A	T	3: 96,871,480	F426I	probably damaging	Het
Hinfp	T	C	9: 44,296,327	I461V	possibly damaging	Het
Hsd11b1	A	T	1: 193,240,248	V167D	probably damaging	Het
Htt	A	G	5: 34,896,908	K2574E	probably benign	Het
I830077J02Rik	A	G	3: 105,926,505	S112P	probably benign	Het
Igf2bp3	T	A	6: 49,105,617	M344L	probably benign	Het
Itch	A	T	2: 155,202,257	Q494L	probably benign	Het
Jaml	T	A	9: 45,093,767	D152E	probably benign	Het
Kif22	A	C	7: 127,042,400	M1R	probably null	Het
Kifap3	T	C	1: 163,883,386	Y663H	probably benign	Het
Letm2	T	A	8: 25,578,770	N472I	probably damaging	Het
Mthfr	T	G	4: 148,052,224	V446G	probably damaging	Het
Myh11	T	C	16: 14,211,260	E1206G	possibly damaging	Het
Myo6	G	A	9: 80,288,056	V903I	probably damaging	Het
Myo9b	C	T	8: 71,355,225		probably benign	Het
Nr2f2	G	C	7: 70,360,175	P52R	probably damaging	Het
Nsd3	A	G	8: 25,683,257	N859S	probably benign	Het
Nucb2	C	A	7: 116,536,010	A384E	probably damaging	Het
Ogdhl	C	A	14: 32,342,037		probably null	Het
Olfr119	C	A	17: 37,701,058	C129*	probably null	Het
Olfr1247	G	A	2: 89,609,863	L80F	probably damaging	Het
Olfr1357	T	C	10: 78,611,871	T257A	probably benign	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr381	A	T	11: 73,486,575	L83Q	probably benign	Het
Parp10	C	T	15: 76,242,633	S145N	probably benign	Het
Pigh	A	G	12: 79,083,709		probably benign	Het
Pigo	A	G	4: 43,023,824		probably benign	Het
Pkp4	T	A	2: 59,305,488	V199D	possibly damaging	Het
Polr1e	C	A	4: 45,025,143		probably null	Het
Ppfia3	C	A	7: 45,348,534	R723L	probably damaging	Het
Prex1	C	A	2: 166,585,898	A945S	possibly damaging	Het
Prrt3	A	T	6: 113,495,840	V457E	probably damaging	Het
Rab39	A	G	9: 53,705,971	F49L	possibly damaging	Het
Rrs1	C	A	1: 9,545,762		probably null	Het
Rrs1	G	A	1: 9,545,767	E82K	probably damaging	Het
Serpinb3c	T	C	1: 107,276,992	D8G	probably benign	Het
Slc17a6	A	G	7: 51,646,180		probably benign	Het
Slc24a4	T	A	12: 102,228,951		probably null	Het
Smc1b	C	T	15: 85,123,759	M272I	probably benign	Het
Smc6	T	C	12: 11,283,178		probably benign	Het
Tcf20	T	C	15: 82,855,085	T722A	probably benign	Het
Tesmin	A	T	19: 3,404,088	M141L	probably benign	Het
Tmprss5	T	A	9: 49,113,160	H274Q	possibly damaging	Het
Tns1	C	T	1: 73,937,318		probably null	Het
Tpr	T	C	1: 150,417,427	S868P	possibly damaging	Het
Trank1	C	T	9: 111,366,253	T1115I	probably damaging	Het
Trmt44	A	T	5: 35,572,917	I203K	possibly damaging	Het
Ulk2	A	T	11: 61,777,785	V1037E	probably benign	Het
Usp43	A	G	11: 67,876,499	Y682H	probably damaging	Het
Vipr2	A	T	12: 116,142,882	Q366L	probably damaging	Het
Vmn1r185	C	A	7: 26,611,589	V164L	possibly damaging	Het
Vmn2r120	C	T	17: 57,525,052	V246I	probably benign	Het
Wdr66	T	C	5: 123,283,447	V182A	probably damaging	Het
Wiz	C	T	17: 32,357,033	G790R	probably damaging	Het
Wnk1	A	T	6: 119,952,733	S1016R	probably damaging	Het
Zc3hav1	A	G	6: 38,311,174	L909S	probably benign	Het
Zfp236	T	A	18: 82,640,227	I637F	probably damaging	Het
Zfp788	G	A	7: 41,649,596	G532D	probably damaging	Het
Zranb1	T	C	7: 132,950,385	I255T	probably damaging	Het

Other mutations in Itga9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01310:Itga9	APN	9	118769159	start codon destroyed	probably null	0.02
IGL01396:Itga9	APN	9	118607123	splice site	probably benign
IGL01476:Itga9	APN	9	118607111	missense	probably damaging	1.00
IGL01573:Itga9	APN	9	118877230	splice site	probably benign
IGL01958:Itga9	APN	9	118636494	splice site	probably benign
IGL02060:Itga9	APN	9	118661432	missense	probably damaging	1.00
IGL02146:Itga9	APN	9	118834332	missense	possibly damaging	0.50
IGL02391:Itga9	APN	9	118850805	missense	probably benign	0.19
IGL02947:Itga9	APN	9	118658533	missense	probably damaging	1.00
IGL03014:Itga9	UTSW	9	118628144	missense	probably benign
R0052:Itga9	UTSW	9	118636549	missense	probably damaging	1.00
R0052:Itga9	UTSW	9	118636549	missense	probably damaging	1.00
R0142:Itga9	UTSW	9	118636586	missense	probably damaging	0.96
R0179:Itga9	UTSW	9	118661386	missense	probably benign	0.11
R0364:Itga9	UTSW	9	118841142	missense	probably benign
R0458:Itga9	UTSW	9	118681028	critical splice donor site	probably null
R1486:Itga9	UTSW	9	118626450	missense	probably damaging	0.98
R1589:Itga9	UTSW	9	118607117	critical splice donor site	probably null
R1620:Itga9	UTSW	9	118843502	missense	probably benign	0.00
R1711:Itga9	UTSW	9	118698461	missense	probably benign	0.00
R1721:Itga9	UTSW	9	118698306	splice site	probably benign
R2064:Itga9	UTSW	9	118807293	missense	probably damaging	0.99
R2201:Itga9	UTSW	9	118877115	splice site	probably benign
R2851:Itga9	UTSW	9	118636536	missense	probably damaging	0.98
R2853:Itga9	UTSW	9	118636536	missense	probably damaging	0.98
R3962:Itga9	UTSW	9	118628186	missense	possibly damaging	0.57
R4180:Itga9	UTSW	9	118607078	missense	probably damaging	1.00
R4597:Itga9	UTSW	9	118843514	missense	probably damaging	1.00
R4716:Itga9	UTSW	9	118681758	missense	probably damaging	0.98
R4929:Itga9	UTSW	9	118807249	missense	probably damaging	1.00
R5002:Itga9	UTSW	9	118663898	nonsense	probably null
R5279:Itga9	UTSW	9	118628205	missense	probably damaging	1.00
R5542:Itga9	UTSW	9	118843661	missense	possibly damaging	0.86
R5869:Itga9	UTSW	9	118663889	missense	probably damaging	1.00
R6372:Itga9	UTSW	9	118897321	missense	probably damaging	1.00
R6470:Itga9	UTSW	9	118897267	missense	probably damaging	0.99
R6581:Itga9	UTSW	9	118658564	missense	probably benign	0.00
R6919:Itga9	UTSW	9	118887815	missense	probably damaging	1.00
R7034:Itga9	UTSW	9	118698365	missense	probably benign	0.00
R7036:Itga9	UTSW	9	118698365	missense	probably benign	0.00
R7043:Itga9	UTSW	9	118769116	missense	probably damaging	0.96
R7237:Itga9	UTSW	9	118636602	missense	probably benign	0.09
R7491:Itga9	UTSW	9	118769111	missense	probably damaging	0.99
R7629:Itga9	UTSW	9	118698446	missense	probably benign	0.00
R7774:Itga9	UTSW	9	118871900	missense	probably damaging	1.00
R7782:Itga9	UTSW	9	118843644	missense
R7789:Itga9	UTSW	9	118658496	missense	possibly damaging	0.80
R7904:Itga9	UTSW	9	118877226	splice site	probably null
R8086:Itga9	UTSW	9	118850801	missense	probably benign
R8158:Itga9	UTSW	9	118877143	missense	probably damaging	0.99
R8204:Itga9	UTSW	9	118871921	missense	probably damaging	1.00
R8895:Itga9	UTSW	9	118681767	missense	probably damaging	1.00
R9074:Itga9	UTSW	9	118807276	missense	probably damaging	1.00
R9090:Itga9	UTSW	9	118671791	missense	possibly damaging	0.93
R9271:Itga9	UTSW	9	118671791	missense	possibly damaging	0.93
R9318:Itga9	UTSW	9	118626468	missense	probably benign	0.03
R9434:Itga9	UTSW	9	118807247	missense	probably damaging	1.00
Z1176:Itga9	UTSW	9	118843530	missense	probably benign	0.00
Z1176:Itga9	UTSW	9	118887839	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGCAACAGAGACCCAGACAAATTG -3'
(R):5'- TGACCAGTAGGGCTCAAATGGCAC -3'

Sequencing Primer
(F):5'- TTGTACATGGCAGAATGAGTCCC -3'
(R):5'- gagagagagagagagagagagagag -3'

Posted On

2013-05-09