Incidental Mutation 'R4557:Ttc27'
ID341929
Institutional Source Beutler Lab
Gene Symbol Ttc27
Ensembl Gene ENSMUSG00000024078
Gene Nametetratricopeptide repeat domain 27
Synonyms2610511O17Rik
MMRRC Submission 041784-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R4557 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location74717750-74863570 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 74829549 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 584 (S584A)
Ref Sequence ENSEMBL: ENSMUSP00000024882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024882]
Predicted Effect probably benign
Transcript: ENSMUST00000024882
AA Change: S584A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000024882
Gene: ENSMUSG00000024078
AA Change: S584A

DomainStartEndE-ValueType
TPR 531 564 7.34e-3 SMART
TPR 565 598 5.56e-3 SMART
TPR 599 632 3.81e-1 SMART
Blast:TPR 633 666 7e-15 BLAST
coiled coil region 817 847 N/A INTRINSIC
Meta Mutation Damage Score 0.1546 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830005F24Rik T C 13: 48,514,461 probably benign Het
Acad11 T C 9: 104,082,839 F219L probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adamts17 A T 7: 67,027,893 E518D probably damaging Het
Adamts3 A G 5: 89,700,487 Y659H probably benign Het
Adgrb3 T C 1: 25,084,279 R1414G probably damaging Het
Apba1 T A 19: 23,917,592 I464N probably damaging Het
Bahcc1 A G 11: 120,275,088 T1057A probably damaging Het
Bcl11a A G 11: 24,164,004 E449G probably damaging Het
Ccdc162 T A 10: 41,587,388 I1453L probably benign Het
Ccdc175 T A 12: 72,128,306 E531V probably benign Het
Cep68 A T 11: 20,239,113 probably benign Het
Dlgap1 C A 17: 70,516,689 T223K probably benign Het
Exoc1 G A 5: 76,561,443 V24M probably damaging Het
Fbxo4 A G 15: 3,965,705 *386R probably null Het
Gm10100 G A 10: 77,726,531 probably benign Het
Gpr149 A G 3: 62,530,870 V622A probably damaging Het
Gpr149 A C 3: 62,604,497 M27R probably benign Het
Ighv3-6 T C 12: 114,288,198 N101D probably benign Het
Igkv4-78 A G 6: 69,059,771 S93P possibly damaging Het
Kmt2c A T 5: 25,300,315 W3332R probably damaging Het
Marf1 T C 16: 14,153,977 probably benign Het
Mcrs1 A G 15: 99,243,147 I459T probably benign Het
Mdn1 G T 4: 32,754,437 C4646F probably damaging Het
Med17 T C 9: 15,271,697 K351E possibly damaging Het
Nalcn T C 14: 123,321,235 probably benign Het
Olfr389 G A 11: 73,776,481 T282I possibly damaging Het
Olfr398 A T 11: 73,984,599 V3E probably benign Het
Olfr761 C A 17: 37,952,251 A258S probably benign Het
Olfr816 A G 10: 129,911,529 Y250H probably damaging Het
Phrf1 C T 7: 141,258,929 probably benign Het
Pitpnm1 A G 19: 4,103,085 Q135R probably benign Het
Prdm16 T A 4: 154,528,827 M48L probably benign Het
Ptpn13 A G 5: 103,541,110 E923G probably damaging Het
Rp1 A T 1: 4,344,663 S2075R possibly damaging Het
Sft2d2 A G 1: 165,183,984 C114R probably damaging Het
Sipa1l2 T G 8: 125,464,415 R945S probably damaging Het
Slc12a1 A G 2: 125,186,641 N517S probably damaging Het
Slc44a2 T G 9: 21,346,783 L443R possibly damaging Het
Smok4a T C 17: 13,526,381 noncoding transcript Het
Snx18 A G 13: 113,617,828 S190P probably damaging Het
Thap12 A G 7: 98,715,845 N407D probably benign Het
Tmc5 T C 7: 118,670,733 I902T probably benign Het
Ttn A T 2: 76,949,015 Y1174N probably damaging Het
Zbtb44 T G 9: 31,064,248 S391R probably damaging Het
Other mutations in Ttc27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Ttc27 APN 17 74780816 missense probably damaging 1.00
IGL01508:Ttc27 APN 17 74835357 missense probably damaging 0.98
IGL02010:Ttc27 APN 17 74780911 splice site probably benign
IGL02189:Ttc27 APN 17 74729899 missense probably damaging 0.99
IGL02487:Ttc27 APN 17 74856554 missense probably damaging 1.00
IGL02745:Ttc27 APN 17 74739733 missense probably benign 0.37
IGL02816:Ttc27 APN 17 74747774 splice site probably benign
IGL03389:Ttc27 APN 17 74858033 missense probably benign 0.00
R0024:Ttc27 UTSW 17 74770264 missense possibly damaging 0.79
R0511:Ttc27 UTSW 17 74718715 missense probably benign 0.22
R0518:Ttc27 UTSW 17 74856549 missense possibly damaging 0.80
R0521:Ttc27 UTSW 17 74856549 missense possibly damaging 0.80
R0633:Ttc27 UTSW 17 74729977 missense probably benign 0.02
R1415:Ttc27 UTSW 17 74739672 missense probably benign
R1597:Ttc27 UTSW 17 74863407 missense possibly damaging 0.95
R1961:Ttc27 UTSW 17 74780856 missense probably damaging 0.99
R2038:Ttc27 UTSW 17 74856502 missense probably benign 0.00
R3012:Ttc27 UTSW 17 74840459 missense probably benign 0.17
R3619:Ttc27 UTSW 17 74751128 splice site probably null
R4155:Ttc27 UTSW 17 74840460 missense probably benign 0.09
R4272:Ttc27 UTSW 17 74840360 missense probably damaging 1.00
R4291:Ttc27 UTSW 17 74856479 missense probably damaging 1.00
R5068:Ttc27 UTSW 17 74799342 missense probably damaging 1.00
R5069:Ttc27 UTSW 17 74799342 missense probably damaging 1.00
R5070:Ttc27 UTSW 17 74799342 missense probably damaging 1.00
R5074:Ttc27 UTSW 17 74747755 missense probably damaging 1.00
R5169:Ttc27 UTSW 17 74747695 nonsense probably null
R5203:Ttc27 UTSW 17 74777654 missense probably damaging 1.00
R5272:Ttc27 UTSW 17 74742977 missense probably damaging 1.00
R6260:Ttc27 UTSW 17 74858091 missense probably damaging 0.99
R6797:Ttc27 UTSW 17 74729888 missense probably benign 0.28
R6830:Ttc27 UTSW 17 74856555 nonsense probably null
R6987:Ttc27 UTSW 17 74777741 critical splice donor site probably null
R7121:Ttc27 UTSW 17 74747715 missense probably benign 0.04
R7393:Ttc27 UTSW 17 74770264 missense possibly damaging 0.79
R7543:Ttc27 UTSW 17 74717750 start gained probably benign
R7635:Ttc27 UTSW 17 74718715 missense probably benign 0.22
R8231:Ttc27 UTSW 17 74717964 missense probably benign 0.19
R8365:Ttc27 UTSW 17 74747674 missense probably damaging 1.00
R8464:Ttc27 UTSW 17 74717930 missense probably benign
R8493:Ttc27 UTSW 17 74743052 critical splice donor site probably null
X0026:Ttc27 UTSW 17 74856437 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GTTCTGAATTCTGCAGAGAAGTG -3'
(R):5'- TCAACTGGTAAGTAGATGCAGTGATC -3'

Sequencing Primer
(F):5'- AATTCTGCAGAGAAGTGTAGTTTTTG -3'
(R):5'- GTGATCTGCCCTAACAACAGAAGATG -3'
Posted On2015-09-24