Incidental Mutation 'R4577:Nup88'
List |< first << previous [record 43 of 71] next >> last >|
ID342568
Institutional Source Beutler Lab
Gene Symbol Nup88
Ensembl Gene ENSMUSG00000040667
Gene Namenucleoporin 88
SynonymsNup84, Prei2
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R4577 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location70943058-70969973 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 70969717 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 55 (A55S)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018593] [ENSMUST00000035283] [ENSMUST00000108529] [ENSMUST00000108530] [ENSMUST00000108531] [ENSMUST00000154430] [ENSMUST00000167509] [ENSMUST00000169965] [ENSMUST00000171254] [ENSMUST00000178822]
Predicted Effect probably benign
Transcript: ENSMUST00000018593
SMART Domains Protein: ENSMUSP00000018593
Gene: ENSMUSG00000018449

DomainStartEndE-ValueType
Pfam:RPA_interact_N 8 47 1.7e-21 PFAM
Pfam:RPA_interact_M 59 127 1.1e-14 PFAM
Pfam:RPA_interact_C 136 217 2.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000035283
AA Change: A79S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000048101
Gene: ENSMUSG00000040667
AA Change: A79S

DomainStartEndE-ValueType
Pfam:Nup88 13 752 1.1e-306 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108529
SMART Domains Protein: ENSMUSP00000104169
Gene: ENSMUSG00000018449

DomainStartEndE-ValueType
Pfam:RPA_interact_N 7 48 7.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108530
AA Change: A79S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000104170
Gene: ENSMUSG00000040667
AA Change: A79S

DomainStartEndE-ValueType
Pfam:Nup88 11 742 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108531
AA Change: A79S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000104171
Gene: ENSMUSG00000040667
AA Change: A79S

DomainStartEndE-ValueType
Pfam:Nup88 11 747 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129531
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136665
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138634
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148168
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151608
Predicted Effect probably benign
Transcript: ENSMUST00000154430
SMART Domains Protein: ENSMUSP00000137113
Gene: ENSMUSG00000018449

DomainStartEndE-ValueType
Pfam:RPA_interact_N 7 38 1.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167509
SMART Domains Protein: ENSMUSP00000127315
Gene: ENSMUSG00000018449

DomainStartEndE-ValueType
Pfam:RPA_interact_N 7 48 2.7e-23 PFAM
Pfam:RPA_interact_M 58 128 5.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169965
SMART Domains Protein: ENSMUSP00000128903
Gene: ENSMUSG00000018449

DomainStartEndE-ValueType
Pfam:RPA_interact_N 7 48 1e-23 PFAM
Pfam:RPA_interact_M 58 106 6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171254
SMART Domains Protein: ENSMUSP00000133243
Gene: ENSMUSG00000018449

DomainStartEndE-ValueType
Pfam:RPA_interact_N 7 48 1.1e-23 PFAM
Pfam:RPA_interact_M 58 107 3.1e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178253
AA Change: A55S

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000178822
SMART Domains Protein: ENSMUSP00000136592
Gene: ENSMUSG00000018449

DomainStartEndE-ValueType
Pfam:RPA_interact_N 7 48 2.7e-23 PFAM
Pfam:RPA_interact_M 58 128 5.3e-16 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins, a family of 50 to 100 proteins, are the main components of the nuclear pore complex in eukaryotic cells. The protein encoded by this gene belongs to the nucleoporin family and is associated with the oncogenic nucleoporin CAN/Nup214 in a dynamic subcomplex. This protein is also overexpressed in a large number of malignant neoplasms and precancerous dysplasias. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A G 7: 139,978,130 I51T probably damaging Het
Abca1 C A 4: 53,062,568 C1429F possibly damaging Het
Acacb A G 5: 114,226,831 E1524G probably damaging Het
Ankrd50 A G 3: 38,455,941 V759A probably damaging Het
Ano9 T C 7: 141,104,138 Q538R probably damaging Het
Bnip2 A G 9: 69,997,162 D67G probably benign Het
Cacna1e A T 1: 154,402,027 S2060T possibly damaging Het
Cand2 G A 6: 115,791,259 C455Y probably damaging Het
Cdh16 T C 8: 104,618,559 D366G probably damaging Het
Cep170b A G 12: 112,744,718 R595G probably damaging Het
Chaf1a G A 17: 56,065,184 R784Q probably damaging Het
Clca4a C A 3: 144,954,969 S698I probably damaging Het
Dnah5 A C 15: 28,289,250 Y1195S probably benign Het
Dysf T C 6: 84,137,326 I1229T probably damaging Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Ep300 T C 15: 81,649,009 S1756P unknown Het
Ep300 T A 15: 81,611,410 probably benign Het
F3 A G 3: 121,734,114 I254V probably benign Het
Fam166a T C 2: 25,220,288 S71P probably benign Het
Frmd4a C A 2: 4,603,679 A786E possibly damaging Het
Fsd1l T C 4: 53,686,397 F270S probably damaging Het
Galnt3 T C 2: 66,097,859 Y231C probably benign Het
Gm10220 A C 5: 26,117,871 I181S probably benign Het
Gm13178 A C 4: 144,703,753 I222S probably damaging Het
Gnb5 G A 9: 75,343,541 V316I possibly damaging Het
Gys2 A G 6: 142,454,510 F325S possibly damaging Het
Hmgn2 G A 4: 133,967,357 probably benign Het
Hsph1 A G 5: 149,618,843 V705A probably benign Het
Ighg2b T C 12: 113,306,892 E206G unknown Het
Iqub A T 6: 24,501,291 I220N probably damaging Het
Jmjd1c A G 10: 67,249,750 T2259A probably damaging Het
Kcnq3 T C 15: 66,286,214 K4R unknown Het
Klk12 A G 7: 43,773,243 D198G probably damaging Het
L3mbtl2 G A 15: 81,686,285 E655K probably benign Het
Lrp1b C T 2: 40,821,719 C3163Y probably damaging Het
Map3k19 T A 1: 127,822,813 R934* probably null Het
Map4 A G 9: 110,081,421 T1061A possibly damaging Het
Mbnl1 G A 3: 60,529,778 V50I probably damaging Het
Med15 G A 16: 17,674,515 Q132* probably null Het
Mef2a T C 7: 67,240,439 N131S probably benign Het
Mtmr3 G C 11: 4,497,375 L361V probably damaging Het
Myo5a A G 9: 75,217,545 E1792G probably damaging Het
Olfr1252 T C 2: 89,722,043 K23E possibly damaging Het
Olfr374 T A 8: 72,110,323 Y252* probably null Het
Pacs1 G T 19: 5,143,833 S556* probably null Het
Parp4 A G 14: 56,590,410 E206G probably benign Het
Paxbp1 T G 16: 91,015,154 K889N probably damaging Het
Pcdhga2 G A 18: 37,669,249 A49T possibly damaging Het
Pcsk6 T A 7: 65,959,266 L292* probably null Het
Plb1 C T 5: 32,247,557 Q20* probably null Het
Plec C A 15: 76,184,069 Q1142H possibly damaging Het
Pnpla2 T C 7: 141,457,344 S87P probably damaging Het
Prss28 T C 17: 25,310,105 V140A probably damaging Het
Rad17 A T 13: 100,633,278 S258T probably damaging Het
Rnf111 A T 9: 70,429,584 C932* probably null Het
Sdc2 T C 15: 33,017,132 Y31H probably damaging Het
Selenoh T C 2: 84,670,331 E55G possibly damaging Het
Serpina3k T G 12: 104,344,192 V327G possibly damaging Het
Setd1b A G 5: 123,148,616 E575G unknown Het
Slco1a4 A T 6: 141,819,540 S325R probably damaging Het
Smtnl1 C A 2: 84,818,443 V156L possibly damaging Het
Speg A G 1: 75,415,395 D1607G probably damaging Het
Tctex1d4 A G 4: 117,128,615 T212A possibly damaging Het
Tmem101 T A 11: 102,155,837 M69L possibly damaging Het
Treh G A 9: 44,685,911 M542I probably benign Het
Trim30b T C 7: 104,357,331 Y106C possibly damaging Het
Ttc6 T C 12: 57,576,655 I280T probably benign Het
Ubtfl1 A G 9: 18,409,493 T106A probably damaging Het
Wdr27 T C 17: 14,903,462 H583R probably benign Het
Xirp2 C T 2: 67,513,897 P2161S probably damaging Het
Other mutations in Nup88
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02081:Nup88 APN 11 70954654 splice site probably benign
IGL02219:Nup88 APN 11 70969692 missense probably benign 0.45
IGL02433:Nup88 APN 11 70969888 missense probably benign 0.13
IGL02666:Nup88 APN 11 70943869 intron probably benign
IGL02669:Nup88 APN 11 70956284 missense probably damaging 0.99
IGL02951:Nup88 APN 11 70944872 missense possibly damaging 0.94
unholy UTSW 11 70956192 missense probably damaging 1.00
PIT4515001:Nup88 UTSW 11 70944721 missense probably benign 0.00
R0445:Nup88 UTSW 11 70947729 missense probably benign 0.44
R0737:Nup88 UTSW 11 70969950 start codon destroyed probably null 0.90
R0920:Nup88 UTSW 11 70956320 missense possibly damaging 0.80
R1337:Nup88 UTSW 11 70944890 missense probably damaging 1.00
R2208:Nup88 UTSW 11 70965719 missense probably damaging 1.00
R3735:Nup88 UTSW 11 70956192 missense probably damaging 1.00
R4600:Nup88 UTSW 11 70969696 nonsense probably null
R4663:Nup88 UTSW 11 70965846 splice site probably null
R4812:Nup88 UTSW 11 70965726 missense probably damaging 1.00
R4824:Nup88 UTSW 11 70961624 missense probably benign 0.10
R5333:Nup88 UTSW 11 70945016 intron probably benign
R5338:Nup88 UTSW 11 70944908 missense probably damaging 0.98
R5443:Nup88 UTSW 11 70958430 nonsense probably null
R5605:Nup88 UTSW 11 70944070 intron probably benign
R5869:Nup88 UTSW 11 70969671 missense probably benign 0.01
R6287:Nup88 UTSW 11 70965755 missense probably benign 0.39
R6364:Nup88 UTSW 11 70947786 missense probably benign
R6409:Nup88 UTSW 11 70944972 missense probably null 0.71
R6555:Nup88 UTSW 11 70944180 missense possibly damaging 0.62
R7203:Nup88 UTSW 11 70945254 missense probably benign 0.20
R7606:Nup88 UTSW 11 70961615 missense possibly damaging 0.89
R7620:Nup88 UTSW 11 70969779 missense probably benign 0.00
R7681:Nup88 UTSW 11 70969885 missense probably benign 0.05
R7956:Nup88 UTSW 11 70943874 splice site probably null
Predicted Primers PCR Primer
(F):5'- ATTACGGAGCTTGTGCATGC -3'
(R):5'- AACCACGTCGTGTTCTTGC -3'

Sequencing Primer
(F):5'- CTGGGCTACATAGTGATTCCAGAC -3'
(R):5'- CGTGTTCTTGCGGCTCCG -3'
Posted On2015-09-24