Incidental Mutation 'R0271:Tpx2'
ID35284
Institutional Source Beutler Lab
Gene Symbol Tpx2
Ensembl Gene ENSMUSG00000027469
Gene NameTPX2, microtubule-associated
SynonymsDIL2, p100, REPP86
MMRRC Submission 038497-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0271 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location152847964-152895321 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 152867367 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028969] [ENSMUST00000109816] [ENSMUST00000164120] [ENSMUST00000178997]
Predicted Effect probably benign
Transcript: ENSMUST00000028969
SMART Domains Protein: ENSMUSP00000028969
Gene: ENSMUSG00000027469

DomainStartEndE-ValueType
Pfam:Aurora-A_bind 1 68 7.4e-39 PFAM
coiled coil region 213 242 N/A INTRINSIC
Pfam:TPX2_importin 360 541 1e-62 PFAM
low complexity region 608 619 N/A INTRINSIC
Pfam:TPX2 661 717 6.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109816
SMART Domains Protein: ENSMUSP00000105441
Gene: ENSMUSG00000027469

DomainStartEndE-ValueType
Pfam:Aurora-A_bind 1 68 7.4e-39 PFAM
coiled coil region 213 242 N/A INTRINSIC
Pfam:TPX2_importin 360 541 1e-62 PFAM
low complexity region 608 619 N/A INTRINSIC
Pfam:TPX2 661 717 6.3e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144848
Predicted Effect probably benign
Transcript: ENSMUST00000164120
SMART Domains Protein: ENSMUSP00000128888
Gene: ENSMUSG00000027469

DomainStartEndE-ValueType
Pfam:Aurora-A_bind 1 68 5.2e-40 PFAM
coiled coil region 213 242 N/A INTRINSIC
Pfam:TPX2_importin 362 489 2.7e-35 PFAM
low complexity region 608 619 N/A INTRINSIC
Pfam:TPX2 661 717 7.5e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175928
Predicted Effect probably benign
Transcript: ENSMUST00000178997
SMART Domains Protein: ENSMUSP00000136457
Gene: ENSMUSG00000027469

DomainStartEndE-ValueType
Pfam:Aurora-A_bind 1 68 5.2e-40 PFAM
coiled coil region 213 242 N/A INTRINSIC
Pfam:TPX2_importin 362 489 2.7e-35 PFAM
low complexity region 608 619 N/A INTRINSIC
Pfam:TPX2 661 717 7.5e-15 PFAM
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.2%
  • 20x: 90.6%
Validation Efficiency 100% (65/65)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic arrest at the morula stage, embryonic lethality and tetraploidy of cultured E1.5 embryos. Mice heterozygous for the gene trap allele exhibit aneuploidy and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T C 3: 88,686,329 probably benign Het
4930544D05Rik A G 11: 70,616,648 Q173R possibly damaging Het
Ampd2 C T 3: 108,086,716 probably benign Het
Ankrd17 T C 5: 90,254,799 S1467G possibly damaging Het
Arhgap31 T G 16: 38,602,510 S1065R possibly damaging Het
Arhgef19 G T 4: 141,250,607 M542I probably benign Het
C7 T C 15: 5,015,380 D392G possibly damaging Het
Ccdc138 G A 10: 58,575,823 C671Y probably damaging Het
Cdh8 A G 8: 99,111,715 S498P possibly damaging Het
Cpb2 T A 14: 75,257,709 probably null Het
Cwc22 A C 2: 77,920,858 N389K probably benign Het
Dgkb T A 12: 38,228,026 L550Q probably damaging Het
Dip2c A G 13: 9,615,775 R950G probably damaging Het
Eml6 A G 11: 29,848,949 V437A possibly damaging Het
Fanca T C 8: 123,272,441 probably benign Het
Fgd2 C G 17: 29,367,008 L189V possibly damaging Het
Foxred2 A C 15: 77,943,390 S590A possibly damaging Het
Gm1110 A G 9: 26,920,666 F63S probably damaging Het
Gm14496 A T 2: 181,995,954 M274L probably benign Het
Gm7008 T A 12: 40,223,560 probably benign Het
Gm9922 T A 14: 101,729,553 probably benign Het
Gtf3c3 A T 1: 54,428,812 M222K possibly damaging Het
Hspa1b A G 17: 34,958,832 V59A probably benign Het
Impg1 T C 9: 80,386,879 probably benign Het
Lpcat4 T A 2: 112,243,245 probably null Het
Mipol1 T C 12: 57,460,954 probably benign Het
Mrpl37 C A 4: 107,066,461 R112L possibly damaging Het
Myo18b T C 5: 112,809,685 N1471D possibly damaging Het
Nes G A 3: 87,978,642 E1359K possibly damaging Het
Nipbl A T 15: 8,361,737 V251E possibly damaging Het
Nlrp1b T C 11: 71,161,765 I946V possibly damaging Het
Obscn T G 11: 59,056,742 probably benign Het
Olfr1024 A T 2: 85,904,289 M255K possibly damaging Het
Olfr1239 T A 2: 89,418,158 Y85F probably benign Het
Olfr1491 A T 19: 13,705,135 T103S probably benign Het
Olfr635 T A 7: 103,979,630 I146K possibly damaging Het
Pck2 T C 14: 55,544,584 probably null Het
Pcsk9 A G 4: 106,449,049 probably benign Het
Phyhd1 A T 2: 30,269,822 Q56L probably benign Het
Plxnc1 C T 10: 94,837,918 G1001S probably null Het
Prss52 T C 14: 64,113,678 V304A probably benign Het
Prss55 C T 14: 64,075,607 G276D probably benign Het
Pzp A T 6: 128,519,514 Y252N probably damaging Het
Rad1 T C 15: 10,490,457 probably null Het
Ripply3 A T 16: 94,335,757 E92D possibly damaging Het
Rpp30 T A 19: 36,104,403 D255E probably benign Het
Rsad1 T C 11: 94,548,464 probably benign Het
Serpini2 A G 3: 75,246,578 M358T probably damaging Het
Slc35a1 T A 4: 34,664,125 E331V probably benign Het
Slc38a7 A G 8: 95,845,878 F179L probably damaging Het
Stmn4 C T 14: 66,356,283 Q42* probably null Het
Sytl2 T C 7: 90,403,020 probably benign Het
Tab2 G A 10: 7,919,158 A520V probably benign Het
Tcp10a A G 17: 7,331,156 I162M probably benign Het
Tmprss13 A G 9: 45,333,688 probably benign Het
Tnfrsf14 A G 4: 154,926,597 probably null Het
Vmn2r105 T A 17: 20,234,703 N57I probably damaging Het
Wars C T 12: 108,875,193 V220I probably benign Het
Washc1 T A 17: 66,116,719 D212E possibly damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Wdr43 A G 17: 71,626,825 D139G probably benign Het
Zfp235 A T 7: 24,137,131 H34L possibly damaging Het
Zkscan16 G A 4: 58,952,391 V230I probably benign Het
Other mutations in Tpx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Tpx2 APN 2 152893591 missense probably damaging 1.00
IGL01810:Tpx2 APN 2 152884235 missense probably damaging 1.00
IGL01951:Tpx2 APN 2 152884176 missense probably benign 0.01
IGL02184:Tpx2 APN 2 152882320 nonsense probably null
IGL02422:Tpx2 APN 2 152873144 missense probably benign 0.00
IGL02441:Tpx2 APN 2 152882287 missense possibly damaging 0.88
reddened UTSW 2 152869724 missense probably benign 0.00
Shamed UTSW 2 152873104 missense probably benign
R0063:Tpx2 UTSW 2 152880123 missense probably damaging 0.99
R0076:Tpx2 UTSW 2 152893683 missense probably damaging 1.00
R0311:Tpx2 UTSW 2 152890492 missense probably damaging 0.98
R0617:Tpx2 UTSW 2 152873138 missense probably benign 0.01
R1871:Tpx2 UTSW 2 152893603 missense probably damaging 1.00
R1882:Tpx2 UTSW 2 152869691 missense probably benign
R1990:Tpx2 UTSW 2 152890624 missense probably benign
R1991:Tpx2 UTSW 2 152890624 missense probably benign
R1992:Tpx2 UTSW 2 152890624 missense probably benign
R4686:Tpx2 UTSW 2 152889183 missense possibly damaging 0.62
R4712:Tpx2 UTSW 2 152885038 missense probably damaging 1.00
R4792:Tpx2 UTSW 2 152885096 missense probably damaging 0.98
R4873:Tpx2 UTSW 2 152893615 missense probably benign 0.00
R4875:Tpx2 UTSW 2 152893615 missense probably benign 0.00
R4991:Tpx2 UTSW 2 152869724 missense probably benign 0.00
R5178:Tpx2 UTSW 2 152875549 missense probably benign 0.01
R5757:Tpx2 UTSW 2 152885231 splice site probably null
R6158:Tpx2 UTSW 2 152873104 missense probably benign
R6225:Tpx2 UTSW 2 152876628 missense probably benign
R6539:Tpx2 UTSW 2 152876598 nonsense probably null
R6633:Tpx2 UTSW 2 152867354 missense probably damaging 1.00
R7358:Tpx2 UTSW 2 152876630 missense probably benign
R7741:Tpx2 UTSW 2 152867343 missense possibly damaging 0.84
X0023:Tpx2 UTSW 2 152885028 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CCCTCAGAAGACAGTCTATTGAGGAGAG -3'
(R):5'- GCAAGACACTAACCCTTCTAATGGCAG -3'

Sequencing Primer
(F):5'- TATTGAGGAGAGTATTAGAATCCTGG -3'
(R):5'- CAGCAGGTtggtgtcgc -3'
Posted On2013-05-09