Mutagenetix > Incidental Mutation

Incidental Mutation 'R0271:Nipbl'

35325

Institutional Source

Beutler Lab

Gene Symbol

Nipbl

Ensembl Gene

ENSMUSG00000022141

Gene Name

NIPBL cohesin loading factor

Synonyms

4933421G18Rik, 4921518A06Rik

MMRRC Submission

038497-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.965) question?

Stock #

R0271 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

8320101-8473947 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 8391221 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 251 (V251E)

Ref Sequence

ENSEMBL: ENSMUSP00000059385 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052965]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000052965
AA Change: V251E

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000059385
Gene: ENSMUSG00000022141
AA Change: V251E

Domain	Start	End	E-Value	Type
low complexity region	22	41	N/A	INTRINSIC
low complexity region	322	338	N/A	INTRINSIC
low complexity region	367	376	N/A	INTRINSIC
low complexity region	447	462	N/A	INTRINSIC
low complexity region	473	490	N/A	INTRINSIC
low complexity region	639	652	N/A	INTRINSIC
low complexity region	1020	1037	N/A	INTRINSIC
low complexity region	1081	1097	N/A	INTRINSIC
low complexity region	1102	1107	N/A	INTRINSIC
low complexity region	1114	1139	N/A	INTRINSIC
low complexity region	1165	1176	N/A	INTRINSIC
low complexity region	1389	1396	N/A	INTRINSIC
low complexity region	1577	1586	N/A	INTRINSIC
coiled coil region	1628	1656	N/A	INTRINSIC
Pfam:Cohesin_HEAT	1788	1829	1.1e-14	PFAM
Pfam:Nipped-B_C	2269	2450	2.8e-68	PFAM
low complexity region	2477	2501	N/A	INTRINSIC
low complexity region	2502	2512	N/A	INTRINSIC
low complexity region	2538	2550	N/A	INTRINSIC
low complexity region	2626	2632	N/A	INTRINSIC
low complexity region	2660	2684	N/A	INTRINSIC

Meta Mutation Damage Score

0.1192

Coding Region Coverage

1x: 98.5%
3x: 97.4%
10x: 95.2%
20x: 90.6%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the homolog of the Drosophila melanogaster Nipped-B gene product and fungal Scc2-type sister chromatid cohesion proteins. The Drosophila protein facilitates enhancer-promoter communication of remote enhancers and plays a role in developmental regulation. It is also homologous to a family of chromosomal adherins with broad roles in sister chromatid cohesion, chromosome condensation, and DNA repair. The human protein has a bipartite nuclear targeting sequence and a putative HEAT repeat. Condensins, cohesins and other complexes with chromosome-related functions also contain HEAT repeats. Mutations in this gene result in Cornelia de Lange syndrome, a disorder characterized by dysmorphic facial features, growth delay, limb reduction defects, and mental retardation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice are embryonic lethal. Heterozygous null mice are growth-retarded and show various skeletal anomalies. Heterozygotes for a gene-trap allele are small and show craniofacial, heart, eye, hearing and behavioral defects, delayed bone maturation, reduced body fat, and postnatal mortality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930544D05Rik	A	G	11: 70,507,474 (GRCm39)	Q173R	possibly damaging	Het
Ampd2	C	T	3: 107,994,032 (GRCm39)		probably benign	Het
Ankrd17	T	C	5: 90,402,658 (GRCm39)	S1467G	possibly damaging	Het
Arhgap31	T	G	16: 38,422,872 (GRCm39)	S1065R	possibly damaging	Het
Arhgef19	G	T	4: 140,977,918 (GRCm39)	M542I	probably benign	Het
C7	T	C	15: 5,044,862 (GRCm39)	D392G	possibly damaging	Het
Ccdc138	G	A	10: 58,411,645 (GRCm39)	C671Y	probably damaging	Het
Cdh8	A	G	8: 99,838,347 (GRCm39)	S498P	possibly damaging	Het
Cpb2	T	A	14: 75,495,149 (GRCm39)		probably null	Het
Cwc22	A	C	2: 77,751,202 (GRCm39)	N389K	probably benign	Het
Dgkb	T	A	12: 38,278,025 (GRCm39)	L550Q	probably damaging	Het
Dip2c	A	G	13: 9,665,811 (GRCm39)	R950G	probably damaging	Het
Eml6	A	G	11: 29,798,949 (GRCm39)	V437A	possibly damaging	Het
Fanca	T	C	8: 123,999,180 (GRCm39)		probably benign	Het
Fgd2	C	G	17: 29,585,982 (GRCm39)	L189V	possibly damaging	Het
Foxred2	A	C	15: 77,827,590 (GRCm39)	S590A	possibly damaging	Het
Gm1110	A	G	9: 26,831,962 (GRCm39)	F63S	probably damaging	Het
Gm14496	A	T	2: 181,637,747 (GRCm39)	M274L	probably benign	Het
Gm7008	T	A	12: 40,273,559 (GRCm39)		probably benign	Het
Gm9922	T	A	14: 101,966,989 (GRCm39)		probably benign	Het
Gtf3c3	A	T	1: 54,467,971 (GRCm39)	M222K	possibly damaging	Het
Hspa1b	A	G	17: 35,177,808 (GRCm39)	V59A	probably benign	Het
Impg1	T	C	9: 80,294,161 (GRCm39)		probably benign	Het
Khdc4	T	C	3: 88,593,636 (GRCm39)		probably benign	Het
Lpcat4	T	A	2: 112,073,590 (GRCm39)		probably null	Het
Mipol1	T	C	12: 57,507,740 (GRCm39)		probably benign	Het
Mrpl37	C	A	4: 106,923,658 (GRCm39)	R112L	possibly damaging	Het
Myo18b	T	C	5: 112,957,551 (GRCm39)	N1471D	possibly damaging	Het
Nes	G	A	3: 87,885,949 (GRCm39)	E1359K	possibly damaging	Het
Nlrp1b	T	C	11: 71,052,591 (GRCm39)	I946V	possibly damaging	Het
Obscn	T	G	11: 58,947,568 (GRCm39)		probably benign	Het
Or10q1b	A	T	19: 13,682,499 (GRCm39)	T103S	probably benign	Het
Or4a2	T	A	2: 89,248,502 (GRCm39)	Y85F	probably benign	Het
Or51q1	T	A	7: 103,628,837 (GRCm39)	I146K	possibly damaging	Het
Or5m12	A	T	2: 85,734,633 (GRCm39)	M255K	possibly damaging	Het
Pck2	T	C	14: 55,782,041 (GRCm39)		probably null	Het
Pcsk9	A	G	4: 106,306,246 (GRCm39)		probably benign	Het
Phyhd1	A	T	2: 30,159,834 (GRCm39)	Q56L	probably benign	Het
Plxnc1	C	T	10: 94,673,780 (GRCm39)	G1001S	probably null	Het
Prss52	T	C	14: 64,351,127 (GRCm39)	V304A	probably benign	Het
Prss55	C	T	14: 64,313,056 (GRCm39)	G276D	probably benign	Het
Pzp	A	T	6: 128,496,477 (GRCm39)	Y252N	probably damaging	Het
Rad1	T	C	15: 10,490,543 (GRCm39)		probably null	Het
Ripply3	A	T	16: 94,136,616 (GRCm39)	E92D	possibly damaging	Het
Rpp30	T	A	19: 36,081,803 (GRCm39)	D255E	probably benign	Het
Rsad1	T	C	11: 94,439,290 (GRCm39)		probably benign	Het
Serpini2	A	G	3: 75,153,885 (GRCm39)	M358T	probably damaging	Het
Slc35a1	T	A	4: 34,664,125 (GRCm39)	E331V	probably benign	Het
Slc38a7	A	G	8: 96,572,506 (GRCm39)	F179L	probably damaging	Het
Stmn4	C	T	14: 66,593,732 (GRCm39)	Q42*	probably null	Het
Sytl2	T	C	7: 90,052,228 (GRCm39)		probably benign	Het
Tab2	G	A	10: 7,794,922 (GRCm39)	A520V	probably benign	Het
Tcp10a	A	G	17: 7,598,555 (GRCm39)	I162M	probably benign	Het
Tmprss13	A	G	9: 45,244,986 (GRCm39)		probably benign	Het
Tnfrsf14	A	G	4: 155,011,054 (GRCm39)		probably null	Het
Tpx2	A	G	2: 152,709,287 (GRCm39)		probably benign	Het
Vmn2r105	T	A	17: 20,454,965 (GRCm39)	N57I	probably damaging	Het
Wars1	C	T	12: 108,841,119 (GRCm39)	V220I	probably benign	Het
Washc1	T	A	17: 66,423,714 (GRCm39)	D212E	possibly damaging	Het
Wdr17	C	T	8: 55,146,131 (GRCm39)	A90T	possibly damaging	Het
Wdr43	A	G	17: 71,933,820 (GRCm39)	D139G	probably benign	Het
Zfp235	A	T	7: 23,836,556 (GRCm39)	H34L	possibly damaging	Het
Zkscan16	G	A	4: 58,952,391 (GRCm39)	V230I	probably benign	Het

Other mutations in Nipbl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Nipbl	APN	15	8,396,157 (GRCm39)	missense	probably damaging	0.98
IGL00712:Nipbl	APN	15	8,398,958 (GRCm39)	missense	probably damaging	0.97
IGL00789:Nipbl	APN	15	8,326,353 (GRCm39)	missense	probably damaging	1.00
IGL01025:Nipbl	APN	15	8,379,939 (GRCm39)	missense	possibly damaging	0.46
IGL01087:Nipbl	APN	15	8,379,981 (GRCm39)	missense	possibly damaging	0.67
IGL01474:Nipbl	APN	15	8,340,693 (GRCm39)	missense	possibly damaging	0.63
IGL01537:Nipbl	APN	15	8,380,023 (GRCm39)	missense	probably benign
IGL01723:Nipbl	APN	15	8,364,555 (GRCm39)	missense	possibly damaging	0.71
IGL01749:Nipbl	APN	15	8,391,305 (GRCm39)	missense	probably benign	0.13
IGL02398:Nipbl	APN	15	8,356,574 (GRCm39)	missense	probably damaging	1.00
IGL02437:Nipbl	APN	15	8,388,558 (GRCm39)	missense	probably damaging	1.00
IGL02450:Nipbl	APN	15	8,373,058 (GRCm39)	missense	probably damaging	0.99
IGL02477:Nipbl	APN	15	8,353,131 (GRCm39)	splice site	probably null
IGL02547:Nipbl	APN	15	8,381,082 (GRCm39)	missense	probably benign
IGL02678:Nipbl	APN	15	8,380,594 (GRCm39)	missense	possibly damaging	0.92
IGL02679:Nipbl	APN	15	8,325,037 (GRCm39)	missense	probably benign	0.34
IGL03003:Nipbl	APN	15	8,379,798 (GRCm39)	missense	probably damaging	1.00
IGL03117:Nipbl	APN	15	8,361,936 (GRCm39)	missense	probably damaging	1.00
IGL03162:Nipbl	APN	15	8,368,463 (GRCm39)	missense	probably benign	0.37
IGL03224:Nipbl	APN	15	8,322,569 (GRCm39)	missense	probably damaging	0.98
IGL03339:Nipbl	APN	15	8,380,360 (GRCm39)	missense	probably benign	0.12
R0346_Nipbl_297	UTSW	15	8,390,440 (GRCm39)	missense	probably damaging	0.99
R0347_Nipbl_476	UTSW	15	8,380,216 (GRCm39)	missense	probably benign
R3620_nipbl_616	UTSW	15	8,362,508 (GRCm39)	missense	probably damaging	0.99
R6388_Nipbl_651	UTSW	15	8,330,268 (GRCm39)	missense	probably damaging	0.99
R8441_Nipbl_224	UTSW	15	8,322,599 (GRCm39)	missense	probably benign	0.00
R0346:Nipbl	UTSW	15	8,390,440 (GRCm39)	missense	probably damaging	0.99
R0347:Nipbl	UTSW	15	8,380,216 (GRCm39)	missense	probably benign
R0422:Nipbl	UTSW	15	8,381,112 (GRCm39)	missense	probably benign
R0486:Nipbl	UTSW	15	8,368,354 (GRCm39)	splice site	probably benign
R0652:Nipbl	UTSW	15	8,332,964 (GRCm39)	missense	probably benign	0.23
R0667:Nipbl	UTSW	15	8,390,488 (GRCm39)	missense	possibly damaging	0.86
R0689:Nipbl	UTSW	15	8,322,562 (GRCm39)	splice site	probably null
R0726:Nipbl	UTSW	15	8,381,039 (GRCm39)	missense	probably benign
R0881:Nipbl	UTSW	15	8,337,096 (GRCm39)	missense	probably damaging	0.98
R0904:Nipbl	UTSW	15	8,391,202 (GRCm39)	missense	probably benign
R0969:Nipbl	UTSW	15	8,321,712 (GRCm39)	missense	probably damaging	1.00
R1401:Nipbl	UTSW	15	8,401,657 (GRCm39)	missense	probably damaging	0.97
R1479:Nipbl	UTSW	15	8,379,773 (GRCm39)	missense	probably benign	0.00
R1495:Nipbl	UTSW	15	8,380,764 (GRCm39)	missense	probably benign	0.00
R1609:Nipbl	UTSW	15	8,396,148 (GRCm39)	missense	probably damaging	1.00
R1679:Nipbl	UTSW	15	8,332,396 (GRCm39)	missense	probably benign	0.31
R1756:Nipbl	UTSW	15	8,368,035 (GRCm39)	missense	possibly damaging	0.91
R1778:Nipbl	UTSW	15	8,348,972 (GRCm39)	missense	probably damaging	1.00
R1835:Nipbl	UTSW	15	8,373,001 (GRCm39)	missense	possibly damaging	0.80
R1883:Nipbl	UTSW	15	8,356,616 (GRCm39)	missense	probably damaging	1.00
R1914:Nipbl	UTSW	15	8,373,114 (GRCm39)	missense	possibly damaging	0.93
R1915:Nipbl	UTSW	15	8,373,114 (GRCm39)	missense	possibly damaging	0.93
R2030:Nipbl	UTSW	15	8,379,771 (GRCm39)	missense	probably damaging	1.00
R2046:Nipbl	UTSW	15	8,353,951 (GRCm39)	missense	probably benign	0.08
R2076:Nipbl	UTSW	15	8,340,691 (GRCm39)	missense	probably benign	0.11
R2163:Nipbl	UTSW	15	8,366,403 (GRCm39)	missense	probably damaging	0.99
R2170:Nipbl	UTSW	15	8,322,702 (GRCm39)	missense	probably damaging	1.00
R2425:Nipbl	UTSW	15	8,380,966 (GRCm39)	missense	probably benign	0.06
R2475:Nipbl	UTSW	15	8,364,490 (GRCm39)	missense	probably benign	0.05
R2484:Nipbl	UTSW	15	8,353,182 (GRCm39)	missense	probably damaging	0.99
R2970:Nipbl	UTSW	15	8,340,723 (GRCm39)	missense	probably damaging	1.00
R3116:Nipbl	UTSW	15	8,373,076 (GRCm39)	missense	probably benign	0.00
R3620:Nipbl	UTSW	15	8,362,508 (GRCm39)	missense	probably damaging	0.99
R3725:Nipbl	UTSW	15	8,325,145 (GRCm39)	missense	probably damaging	0.97
R3745:Nipbl	UTSW	15	8,388,358 (GRCm39)	missense	probably benign
R3902:Nipbl	UTSW	15	8,379,730 (GRCm39)	missense	possibly damaging	0.94
R3960:Nipbl	UTSW	15	8,380,018 (GRCm39)	missense	probably benign
R4164:Nipbl	UTSW	15	8,368,418 (GRCm39)	missense	probably benign	0.24
R4246:Nipbl	UTSW	15	8,361,916 (GRCm39)	missense	probably damaging	1.00
R4381:Nipbl	UTSW	15	8,388,690 (GRCm39)	missense	probably benign	0.00
R4394:Nipbl	UTSW	15	8,391,345 (GRCm39)	missense	probably benign	0.00
R4439:Nipbl	UTSW	15	8,368,208 (GRCm39)	missense	probably damaging	0.98
R4440:Nipbl	UTSW	15	8,396,142 (GRCm39)	missense	probably damaging	0.98
R4441:Nipbl	UTSW	15	8,396,142 (GRCm39)	missense	probably damaging	0.98
R4672:Nipbl	UTSW	15	8,332,468 (GRCm39)	missense	probably damaging	1.00
R4749:Nipbl	UTSW	15	8,395,313 (GRCm39)	missense	possibly damaging	0.95
R5300:Nipbl	UTSW	15	8,380,981 (GRCm39)	missense	probably benign
R5428:Nipbl	UTSW	15	8,359,780 (GRCm39)	missense	probably benign	0.00
R5641:Nipbl	UTSW	15	8,396,196 (GRCm39)	missense	possibly damaging	0.93
R5643:Nipbl	UTSW	15	8,388,391 (GRCm39)	missense	probably benign
R5644:Nipbl	UTSW	15	8,388,391 (GRCm39)	missense	probably benign
R5681:Nipbl	UTSW	15	8,330,866 (GRCm39)	missense	probably benign	0.22
R5741:Nipbl	UTSW	15	8,354,133 (GRCm39)	missense	possibly damaging	0.47
R5899:Nipbl	UTSW	15	8,364,328 (GRCm39)	splice site	probably null
R5970:Nipbl	UTSW	15	8,326,302 (GRCm39)	missense	probably benign	0.27
R6041:Nipbl	UTSW	15	8,353,748 (GRCm39)	missense	probably damaging	1.00
R6059:Nipbl	UTSW	15	8,325,052 (GRCm39)	missense	probably damaging	1.00
R6213:Nipbl	UTSW	15	8,364,390 (GRCm39)	missense	probably damaging	1.00
R6216:Nipbl	UTSW	15	8,347,867 (GRCm39)	missense	probably damaging	0.99
R6236:Nipbl	UTSW	15	8,354,064 (GRCm39)	missense	possibly damaging	0.88
R6267:Nipbl	UTSW	15	8,330,379 (GRCm39)	missense	possibly damaging	0.46
R6296:Nipbl	UTSW	15	8,330,379 (GRCm39)	missense	possibly damaging	0.46
R6388:Nipbl	UTSW	15	8,330,268 (GRCm39)	missense	probably damaging	0.99
R6427:Nipbl	UTSW	15	8,381,049 (GRCm39)	missense	probably benign
R6707:Nipbl	UTSW	15	8,354,043 (GRCm39)	missense	probably benign	0.01
R6731:Nipbl	UTSW	15	8,352,074 (GRCm39)	missense	probably damaging	1.00
R6921:Nipbl	UTSW	15	8,332,969 (GRCm39)	missense	probably benign	0.28
R7239:Nipbl	UTSW	15	8,321,619 (GRCm39)	critical splice donor site	probably null
R7346:Nipbl	UTSW	15	8,373,090 (GRCm39)	missense	possibly damaging	0.94
R7485:Nipbl	UTSW	15	8,359,779 (GRCm39)	missense	probably benign	0.01
R7486:Nipbl	UTSW	15	8,325,120 (GRCm39)	missense	probably benign	0.25
R7598:Nipbl	UTSW	15	8,372,977 (GRCm39)	missense	probably benign	0.24
R7609:Nipbl	UTSW	15	8,335,356 (GRCm39)	missense	probably benign	0.27
R7674:Nipbl	UTSW	15	8,322,585 (GRCm39)	missense	probably benign	0.15
R7706:Nipbl	UTSW	15	8,381,010 (GRCm39)	missense	probably benign	0.01
R7760:Nipbl	UTSW	15	8,388,186 (GRCm39)	missense	probably damaging	1.00
R7766:Nipbl	UTSW	15	8,326,333 (GRCm39)	missense	probably benign	0.45
R7825:Nipbl	UTSW	15	8,320,971 (GRCm39)	missense	probably damaging	1.00
R7862:Nipbl	UTSW	15	8,355,236 (GRCm39)	missense	probably benign	0.06
R7958:Nipbl	UTSW	15	8,340,742 (GRCm39)	missense	possibly damaging	0.91
R8077:Nipbl	UTSW	15	8,340,734 (GRCm39)	missense	possibly damaging	0.49
R8119:Nipbl	UTSW	15	8,388,696 (GRCm39)	missense	probably benign	0.22
R8355:Nipbl	UTSW	15	8,364,528 (GRCm39)	missense	probably damaging	0.98
R8441:Nipbl	UTSW	15	8,322,599 (GRCm39)	missense	probably benign	0.00
R8455:Nipbl	UTSW	15	8,364,528 (GRCm39)	missense	probably damaging	0.98
R8717:Nipbl	UTSW	15	8,368,225 (GRCm39)	missense	probably benign
R8739:Nipbl	UTSW	15	8,332,904 (GRCm39)	missense	probably benign	0.08
R8854:Nipbl	UTSW	15	8,330,210 (GRCm39)	missense	probably damaging	1.00
R8887:Nipbl	UTSW	15	8,391,271 (GRCm39)	missense	probably damaging	1.00
R8942:Nipbl	UTSW	15	8,381,104 (GRCm39)	missense	probably benign
R8991:Nipbl	UTSW	15	8,320,997 (GRCm39)	missense	probably damaging	1.00
R9008:Nipbl	UTSW	15	8,356,608 (GRCm39)	missense	probably damaging	1.00
R9070:Nipbl	UTSW	15	8,368,215 (GRCm39)	missense	possibly damaging	0.82
R9116:Nipbl	UTSW	15	8,380,340 (GRCm39)	missense	probably benign	0.00
R9622:Nipbl	UTSW	15	8,366,373 (GRCm39)	missense	probably benign	0.27
R9778:Nipbl	UTSW	15	8,321,032 (GRCm39)	missense	probably benign	0.10
RF020:Nipbl	UTSW	15	8,388,418 (GRCm39)	missense	probably damaging	0.98
X0022:Nipbl	UTSW	15	8,381,199 (GRCm39)	missense	probably benign	0.05
X0027:Nipbl	UTSW	15	8,353,021 (GRCm39)	missense	probably damaging	1.00
Z1088:Nipbl	UTSW	15	8,337,366 (GRCm39)	missense	probably damaging	1.00
Z1176:Nipbl	UTSW	15	8,368,183 (GRCm39)	missense	possibly damaging	0.88
Z1177:Nipbl	UTSW	15	8,368,164 (GRCm39)	critical splice donor site	probably null
Z1177:Nipbl	UTSW	15	8,366,436 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGCAATTTCAATAAAAGTGCCGTGAC -3'
(R):5'- CAGTGACATCCATCACAGTATCGGG -3'

Sequencing Primer
(F):5'- ACTGAAATTCAACCCTGCTCTATG -3'
(R):5'- gtagcccatgctggcttc -3'

Posted On

2013-05-09