Incidental Mutation 'R4834:Krt8'
ID 373104
Institutional Source Beutler Lab
Gene Symbol Krt8
Ensembl Gene ENSMUSG00000049382
Gene Name keratin 8
Synonyms Krt-2.8, Krt2-8, cytokeratin 8, cytokeratin8, K8, EndoA, cytokeratin-8, Card2
MMRRC Submission 041977-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4834 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 101996698-102004482 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 101998821 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 276 (I276F)
Ref Sequence ENSEMBL: ENSMUSP00000023952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023952]
AlphaFold P11679
Predicted Effect probably damaging
Transcript: ENSMUST00000023952
AA Change: I276F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000023952
Gene: ENSMUSG00000049382
AA Change: I276F

DomainStartEndE-ValueType
Pfam:Keratin_2_head 1 93 9.4e-18 PFAM
Filament 96 407 7.82e-188 SMART
low complexity region 421 438 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the type II keratin family clustered on the long arm of chromosome 12. Type I and type II keratins heteropolymerize to form intermediate-sized filaments in the cytoplasm of epithelial cells. The product of this gene typically dimerizes with keratin 18 to form an intermediate filament in simple single-layered epithelial cells. This protein plays a role in maintaining cellular structural integrity and also functions in signal transduction and cellular differentiation. Mutations in this gene cause cryptogenic cirrhosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele show partial background-sensitive embryonic lethality, placental defects, impaired female fertility, abnormal hematopoiesis, diarrhea, colorectal hyperplasia, anorectal prolapse, and high liver sensitivity to toxins, apoptotic stimuli and diet-induced steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A C 9: 53,432,487 D146A possibly damaging Het
Acsl5 C A 19: 55,280,559 D217E probably benign Het
Acss3 A G 10: 107,084,805 probably null Het
Adam24 G A 8: 40,679,699 G69R probably damaging Het
Adgrg7 A T 16: 56,732,869 W622R probably damaging Het
Ankrd26 T C 6: 118,523,718 M931V probably benign Het
Ano8 C T 8: 71,484,295 V187M probably damaging Het
Ap3d1 A T 10: 80,719,726 C348S probably damaging Het
Apob T C 12: 8,014,101 V376A possibly damaging Het
Arhgap21 A T 2: 20,865,319 D925E probably damaging Het
Bmp6 T A 13: 38,485,841 V367E probably damaging Het
Bmp8b A T 4: 123,123,050 Q348L probably damaging Het
Ccr1l1 T C 9: 123,977,705 K235R probably damaging Het
Cd59a G A 2: 104,114,086 C93Y probably damaging Het
Clstn3 C T 6: 124,431,953 probably null Het
Col4a2 C A 8: 11,406,836 Y236* probably null Het
Csn1s2a T C 5: 87,781,778 F79L probably benign Het
Cyp4a10 A C 4: 115,525,808 Y360S probably damaging Het
Cyp4a29 A T 4: 115,249,670 I175F probably benign Het
D11Wsu47e C A 11: 113,688,979 T400K probably benign Het
Dck T A 5: 88,772,736 I105N probably damaging Het
Dicer1 A G 12: 104,696,591 L1577P probably benign Het
Dirc2 T A 16: 35,735,575 T172S probably benign Het
Disp2 G A 2: 118,792,504 S1239N probably benign Het
Dopey2 T C 16: 93,740,004 M1T probably null Het
E130308A19Rik T A 4: 59,690,317 C50* probably null Het
Elf2 A T 3: 51,277,221 D14E probably damaging Het
Epm2aip1 C T 9: 111,273,194 R412C probably benign Het
Foxm1 T C 6: 128,369,447 F114L probably damaging Het
Glcci1 C T 6: 8,582,601 R134* probably null Het
Gm996 T C 2: 25,579,518 E127G possibly damaging Het
Gspt1 T C 16: 11,222,717 K576E probably damaging Het
H2-M10.3 T C 17: 36,367,394 K180E probably benign Het
Hecw2 A T 1: 53,830,752 V1439E probably damaging Het
Hr T C 14: 70,559,922 S561P probably damaging Het
Hunk T C 16: 90,496,198 V456A probably benign Het
Il1rap T A 16: 26,676,935 D97E probably damaging Het
Inpp5d T G 1: 87,697,523 V474G possibly damaging Het
Itsn1 T A 16: 91,906,789 L87* probably null Het
Izumo3 T C 4: 92,146,971 D3G possibly damaging Het
Kifc2 T A 15: 76,661,311 M1K probably null Het
Ksr2 C A 5: 117,668,327 Q402K probably benign Het
Lama2 A G 10: 27,006,749 V2606A probably benign Het
Met A G 6: 17,491,413 H58R probably damaging Het
Mier3 C T 13: 111,715,109 Q542* probably null Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Msl3l2 C T 10: 56,115,559 R127C probably damaging Het
Naglu T C 11: 101,076,988 L588P probably benign Het
Nf1 T C 11: 79,546,297 L2013P probably damaging Het
Nid1 A G 13: 13,508,823 Y1162C probably damaging Het
Nlrc5 G T 8: 94,505,485 R1313L probably benign Het
Nrg1 A G 8: 31,917,719 V162A probably benign Het
Nup188 T C 2: 30,339,584 L1310P probably damaging Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr1310 A G 2: 112,008,931 L85P probably damaging Het
Olfr290 T G 7: 84,916,283 F168C probably damaging Het
Olfr305 G A 7: 86,363,744 L198F probably benign Het
Pbk T A 14: 65,815,284 L192* probably null Het
Pcdhga4 T C 18: 37,685,437 I13T probably benign Het
Peg10 A T 6: 4,754,294 probably benign Het
Polq T A 16: 37,027,814 V261D probably damaging Het
Ppp2r5b T A 19: 6,230,510 T313S possibly damaging Het
Ptk2 A T 15: 73,216,096 probably null Het
Ptpn7 T A 1: 135,137,880 probably null Het
Rab11fip1 A G 8: 27,153,083 S563P probably damaging Het
Scn1a A T 2: 66,328,522 C351* probably null Het
Slc10a5 A T 3: 10,334,799 V267D probably damaging Het
Slc37a2 T A 9: 37,235,108 M368L probably damaging Het
Slc6a20b T A 9: 123,596,048 T585S probably benign Het
Srcap T C 7: 127,557,610 probably null Het
Tbx18 T C 9: 87,727,449 M178V possibly damaging Het
Tmprss11b C A 5: 86,663,559 C172F probably damaging Het
Traf5 T C 1: 192,066,898 Q91R probably benign Het
Trappc8 A T 18: 20,825,065 Y1248N probably damaging Het
Trpa1 A G 1: 14,896,523 L539S possibly damaging Het
Tyrp1 T A 4: 80,846,596 Y3* probably null Het
Ubr7 A T 12: 102,761,502 K94N probably damaging Het
Ugt2a1 C A 5: 87,486,035 probably null Het
Unc50 T A 1: 37,432,629 I120K probably damaging Het
Usp28 T C 9: 49,001,536 V29A probably damaging Het
Usp9y A G Y: 1,317,002 I1849T probably benign Het
Vmn2r102 T A 17: 19,677,941 V406E probably damaging Het
Vmn2r4 G A 3: 64,410,063 R85W probably benign Het
Xirp2 A G 2: 67,516,406 D2997G probably benign Het
Zc2hc1c A T 12: 85,290,208 E213V probably damaging Het
Zfp420 C T 7: 29,874,334 probably benign Het
Zfp641 C T 15: 98,293,704 E34K probably damaging Het
Other mutations in Krt8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Krt8 APN 15 101998025 missense probably benign
IGL01643:Krt8 APN 15 101997073 missense possibly damaging 0.64
IGL01966:Krt8 APN 15 101997670 missense probably benign 0.08
IGL02587:Krt8 APN 15 101998932 missense probably benign 0.04
IGL03088:Krt8 APN 15 102000587 missense possibly damaging 0.90
R0531:Krt8 UTSW 15 102001448 missense probably benign 0.12
R1451:Krt8 UTSW 15 101998829 missense possibly damaging 0.93
R2258:Krt8 UTSW 15 101998822 missense probably benign
R2348:Krt8 UTSW 15 101998865 missense probably benign 0.31
R2566:Krt8 UTSW 15 101998024 missense probably benign 0.03
R3796:Krt8 UTSW 15 101999442 missense probably benign 0.00
R4965:Krt8 UTSW 15 101996951 missense probably benign
R5212:Krt8 UTSW 15 101997967 missense possibly damaging 0.52
R5249:Krt8 UTSW 15 101998440 missense possibly damaging 0.69
R5419:Krt8 UTSW 15 102003902 missense probably damaging 0.98
R5778:Krt8 UTSW 15 102003939 missense probably damaging 0.99
R5997:Krt8 UTSW 15 102000594 missense possibly damaging 0.77
R6503:Krt8 UTSW 15 101997934 missense possibly damaging 0.66
R6683:Krt8 UTSW 15 101998004 missense probably benign
R6812:Krt8 UTSW 15 101997979 missense probably damaging 0.99
R6824:Krt8 UTSW 15 101998440 missense possibly damaging 0.50
R6875:Krt8 UTSW 15 101997908 missense probably benign 0.44
R7650:Krt8 UTSW 15 102004163 missense probably benign 0.07
R8047:Krt8 UTSW 15 102003971 missense probably damaging 0.99
R8559:Krt8 UTSW 15 102001544 missense probably benign 0.03
R8826:Krt8 UTSW 15 102001435 missense possibly damaging 0.89
R9146:Krt8 UTSW 15 101998935 missense probably damaging 0.98
Z1177:Krt8 UTSW 15 101999435 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTCAGCTGACATCTCACC -3'
(R):5'- TTGCAAAGGGTCCTGTGAACAG -3'

Sequencing Primer
(F):5'- AGTGAAGGCCCCTTTCCAGAC -3'
(R):5'- CTGTGAACAGGGACAGAGCCTTAC -3'
Posted On 2016-03-01