Incidental Mutation 'R9146:Krt8'
ID 694662
Institutional Source Beutler Lab
Gene Symbol Krt8
Ensembl Gene ENSMUSG00000049382
Gene Name keratin 8
Synonyms Krt-2.8, Krt2-8, cytokeratin 8, cytokeratin8, K8, EndoA, cytokeratin-8, Card2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9146 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 101996698-102004482 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 101998935 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 238 (I238F)
Ref Sequence ENSEMBL: ENSMUSP00000023952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023952]
AlphaFold P11679
Predicted Effect probably damaging
Transcript: ENSMUST00000023952
AA Change: I238F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023952
Gene: ENSMUSG00000049382
AA Change: I238F

DomainStartEndE-ValueType
Pfam:Keratin_2_head 1 93 9.4e-18 PFAM
Filament 96 407 7.82e-188 SMART
low complexity region 421 438 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the type II keratin family clustered on the long arm of chromosome 12. Type I and type II keratins heteropolymerize to form intermediate-sized filaments in the cytoplasm of epithelial cells. The product of this gene typically dimerizes with keratin 18 to form an intermediate filament in simple single-layered epithelial cells. This protein plays a role in maintaining cellular structural integrity and also functions in signal transduction and cellular differentiation. Mutations in this gene cause cryptogenic cirrhosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele show partial background-sensitive embryonic lethality, placental defects, impaired female fertility, abnormal hematopoiesis, diarrhea, colorectal hyperplasia, anorectal prolapse, and high liver sensitivity to toxins, apoptotic stimuli and diet-induced steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ache G A 5: 137,290,815 G261D probably damaging Het
Adgrv1 T A 13: 81,413,172 T5408S probably benign Het
Aff3 T C 1: 38,320,119 N362D probably benign Het
Aff4 A G 11: 53,408,136 N956S probably benign Het
Alg10b A G 15: 90,228,198 E415G probably damaging Het
Ate1 T C 7: 130,467,292 Y415C probably damaging Het
Cage1 T C 13: 38,023,029 D280G probably benign Het
Catsperg1 G C 7: 29,210,487 P72R probably benign Het
Cep290 A G 10: 100,541,803 E1565G probably benign Het
Csmd1 T A 8: 15,998,832 Y2290F probably benign Het
Cyp2c39 A T 19: 39,538,900 H230L Het
Efhb A G 17: 53,462,616 S222P probably benign Het
Emilin2 G A 17: 71,274,336 T465M probably damaging Het
Ep400 A T 5: 110,701,769 Y1431* probably null Het
Gm10912 T C 2: 104,066,708 V64A possibly damaging Het
Gpat2 T C 2: 127,431,286 S197P possibly damaging Het
Hc T C 2: 35,034,559 Y452C probably damaging Het
Hectd4 T C 5: 121,349,034 I3364T probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Hmcn1 G A 1: 150,598,390 T4767M probably benign Het
Hspa4l A G 3: 40,781,669 D595G probably benign Het
Kdm1a G T 4: 136,602,428 T53K unknown Het
Kirrel T C 3: 87,095,708 D126G probably damaging Het
Kit T A 5: 75,649,645 D822E probably damaging Het
Kiz C T 2: 146,863,820 T100M probably benign Het
Kmt2a T A 9: 44,814,641 K3663* probably null Het
Ky C T 9: 102,542,206 P471S Het
Lca5l T C 16: 96,159,798 E493G probably damaging Het
Lrrc2 C T 9: 110,979,514 T273I probably damaging Het
Mcoln2 T C 3: 146,163,548 S31P probably benign Het
Mmp1a A G 9: 7,464,997 D77G probably damaging Het
Mrgprb8 T A 7: 48,389,452 C290* probably null Het
Nfe2l3 G T 6: 51,433,192 A96S probably damaging Het
Notch2 A G 3: 98,104,538 D624G probably damaging Het
Nup98 C A 7: 102,138,830 R1011L probably benign Het
Nxt2 C T X: 142,237,751 A118V possibly damaging Het
Olfr666 T A 7: 104,893,245 I128F probably damaging Het
Olfr789 T C 10: 129,487,523 V171A possibly damaging Het
Pcdh10 G A 3: 45,379,916 A222T probably benign Het
Piezo1 G A 8: 122,500,263 H420Y Het
Plcb1 T A 2: 135,340,695 Y642N probably damaging Het
Ralgapa2 T A 2: 146,342,332 H1538L probably benign Het
Raph1 A G 1: 60,518,978 probably null Het
Rnf213 T C 11: 119,443,673 F3237S Het
Sctr A G 1: 120,054,280 D286G probably damaging Het
Smyd3 A G 1: 179,092,964 S202P probably damaging Het
Ssh2 G A 11: 77,437,676 G356E probably damaging Het
Stat3 A T 11: 100,893,666 S629R probably benign Het
Stc2 A G 11: 31,367,847 V58A probably damaging Het
Tcerg1l T A 7: 138,229,859 D463V probably damaging Het
Tctn1 A G 5: 122,251,682 V259A possibly damaging Het
Tmem248 A G 5: 130,232,010 T139A probably benign Het
Trip12 G T 1: 84,794,160 A89E possibly damaging Het
Vmn2r54 C T 7: 12,632,720 V96I probably benign Het
Vmn2r79 C T 7: 87,001,473 Q156* probably null Het
Zfp831 C A 2: 174,645,668 T712N possibly damaging Het
Zfy1 A T Y: 726,033 H577Q possibly damaging Het
Zscan4-ps2 T G 7: 11,517,752 S238R possibly damaging Het
Other mutations in Krt8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Krt8 APN 15 101998025 missense probably benign
IGL01643:Krt8 APN 15 101997073 missense possibly damaging 0.64
IGL01966:Krt8 APN 15 101997670 missense probably benign 0.08
IGL02587:Krt8 APN 15 101998932 missense probably benign 0.04
IGL03088:Krt8 APN 15 102000587 missense possibly damaging 0.90
R0531:Krt8 UTSW 15 102001448 missense probably benign 0.12
R1451:Krt8 UTSW 15 101998829 missense possibly damaging 0.93
R2258:Krt8 UTSW 15 101998822 missense probably benign
R2348:Krt8 UTSW 15 101998865 missense probably benign 0.31
R2566:Krt8 UTSW 15 101998024 missense probably benign 0.03
R3796:Krt8 UTSW 15 101999442 missense probably benign 0.00
R4834:Krt8 UTSW 15 101998821 missense probably damaging 1.00
R4965:Krt8 UTSW 15 101996951 missense probably benign
R5212:Krt8 UTSW 15 101997967 missense possibly damaging 0.52
R5249:Krt8 UTSW 15 101998440 missense possibly damaging 0.69
R5419:Krt8 UTSW 15 102003902 missense probably damaging 0.98
R5778:Krt8 UTSW 15 102003939 missense probably damaging 0.99
R5997:Krt8 UTSW 15 102000594 missense possibly damaging 0.77
R6503:Krt8 UTSW 15 101997934 missense possibly damaging 0.66
R6683:Krt8 UTSW 15 101998004 missense probably benign
R6812:Krt8 UTSW 15 101997979 missense probably damaging 0.99
R6824:Krt8 UTSW 15 101998440 missense possibly damaging 0.50
R6875:Krt8 UTSW 15 101997908 missense probably benign 0.44
R7650:Krt8 UTSW 15 102004163 missense probably benign 0.07
R8047:Krt8 UTSW 15 102003971 missense probably damaging 0.99
R8559:Krt8 UTSW 15 102001544 missense probably benign 0.03
R8826:Krt8 UTSW 15 102001435 missense possibly damaging 0.89
Z1177:Krt8 UTSW 15 101999435 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTCAATGATCCAGGACACAG -3'
(R):5'- TTGATGCTGCCCTTCATGG -3'

Sequencing Primer
(F):5'- AGACCCAGGCTTGTGACC -3'
(R):5'- ATGGCTCAGTTTTGACCCTAATC -3'
Posted On 2022-01-20