Incidental Mutation 'R4850:Slc30a7'
ID 373449
Institutional Source Beutler Lab
Gene Symbol Slc30a7
Ensembl Gene ENSMUSG00000054414
Gene Name solute carrier family 30 (zinc transporter), member 7
Synonyms 2610034N15Rik, 4833428C12Rik, 1810059J10Rik, ZnT-7, ZnT7
MMRRC Submission 042462-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.783) question?
Stock # R4850 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 115938973-116007406 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 115993008 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 72 (F72L)
Ref Sequence ENSEMBL: ENSMUSP00000065254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067485]
AlphaFold Q9JKN1
Predicted Effect probably damaging
Transcript: ENSMUST00000067485
AA Change: F72L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000065254
Gene: ENSMUSG00000054414
AA Change: F72L

DomainStartEndE-ValueType
Pfam:Cation_efflux 38 296 3.3e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197333
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197847
Meta Mutation Damage Score 0.2362 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc functions as a cofactor for numerous enzymes, nuclear factors, and hormones and as an intra- and intercellular signal ion. Members of the zinc transporter (ZNT)/SLC30 subfamily of the cation diffusion facilitator family, such as SLC30A7, permit cellular efflux of zinc (Seve et al., 2004 [PubMed 15154973]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit a low body zinc status, reduced food intake and poor body weight gain, and are lean due to a significant reduction in body fat accumulation; however, no signs of hair growth abnormalities or dermatitis are observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,262,938 S3012P unknown Het
Abcb10 C T 8: 123,982,690 A42T probably benign Het
Acsf3 T C 8: 122,817,436 V551A probably damaging Het
Adgrl2 G A 3: 148,859,020 T304I probably damaging Het
Akr1d1 A G 6: 37,554,587 probably null Het
Ankrd17 A T 5: 90,264,786 H1226Q probably damaging Het
Arap1 T C 7: 101,398,791 I847T probably damaging Het
Atad2b G A 12: 4,943,251 G257S probably benign Het
Cand2 A T 6: 115,801,948 T1158S probably benign Het
Cic G A 7: 25,272,902 R686H probably damaging Het
Cldn1 T A 16: 26,363,163 T99S probably benign Het
Cnga3 G T 1: 37,258,006 E173* probably null Het
Cryge G T 1: 65,051,052 probably benign Het
Dsp T A 13: 38,192,469 L1410H probably damaging Het
Dync2h1 T C 9: 7,134,364 T1548A probably benign Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Eml5 T C 12: 98,790,619 D1917G probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam71d A G 12: 78,715,153 D197G probably damaging Het
Fn3krp A T 11: 121,425,053 H90L possibly damaging Het
Gm10718 A T 9: 3,023,716 T56S probably benign Het
Gm4847 A T 1: 166,642,339 I55K probably damaging Het
Gsn T A 2: 35,283,900 probably null Het
Haghl T C 17: 25,783,006 probably benign Het
Hist1h2bj G T 13: 22,043,251 probably benign Het
Hmg20b T A 10: 81,346,927 E139V probably damaging Het
Hsd3b6 G A 3: 98,807,905 T57I probably benign Het
Igkv5-48 A G 6: 69,726,796 S42P probably damaging Het
Igsf23 T C 7: 19,953,934 probably benign Het
Kcnt1 T C 2: 25,908,100 F874L probably damaging Het
Maf1 T C 15: 76,352,962 F110L possibly damaging Het
Mtpap C T 18: 4,387,044 R365W probably damaging Het
Mtus1 A C 8: 41,084,470 S70A possibly damaging Het
Nfatc1 T A 18: 80,697,865 T307S probably benign Het
Nphs1 T G 7: 30,463,232 S379A possibly damaging Het
Nup205 A G 6: 35,230,530 T1506A probably benign Het
Olfr1044 T A 2: 86,171,671 I49F probably damaging Het
Olfr275 T C 4: 52,825,450 S18P possibly damaging Het
Pcdhga8 A T 18: 37,727,709 Y606F probably damaging Het
Pde7a A G 3: 19,243,117 V123A probably benign Het
Pex1 C T 5: 3,624,426 T809I probably benign Het
Prdm13 C A 4: 21,678,243 R749L possibly damaging Het
Prkcd A G 14: 30,599,743 L498P probably damaging Het
Pros1 A T 16: 62,885,524 E67V probably damaging Het
Rab44 A G 17: 29,140,089 E417G possibly damaging Het
Rangrf A G 11: 68,973,640 probably null Het
Rp1 T A 1: 4,348,675 K738M probably damaging Het
Ryr2 A T 13: 11,668,820 D3119E probably damaging Het
Ryr2 G A 13: 11,745,752 R1482C probably damaging Het
Sbspon T A 1: 15,858,968 T200S probably damaging Het
Sfxn5 T C 6: 85,332,376 probably benign Het
Slc26a8 T A 17: 28,654,883 I377F probably benign Het
Slc32a1 T C 2: 158,614,192 F256L possibly damaging Het
Slco6b1 T C 1: 96,911,833 noncoding transcript Het
Smpd1 A G 7: 105,555,985 H357R probably benign Het
Sncaip A T 18: 52,871,384 H361L probably damaging Het
Tenm2 A C 11: 36,023,488 Y2406* probably null Het
Terb1 T A 8: 104,485,425 H308L probably benign Het
Trim61 A T 8: 65,013,418 L397H probably damaging Het
Trp53bp1 T A 2: 121,205,113 probably null Het
Ttn T G 2: 76,781,555 E9007D possibly damaging Het
Urb1 A T 16: 90,795,414 C319* probably null Het
Vmn2r95 T C 17: 18,451,653 Y551H probably damaging Het
Vwde A T 6: 13,196,048 V326D possibly damaging Het
Xdh A G 17: 73,898,335 L1045P probably damaging Het
Zfp638 T C 6: 83,979,475 I1688T possibly damaging Het
Zwint T A 10: 72,655,956 probably benign Het
Other mutations in Slc30a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Slc30a7 APN 3 115946720 splice site probably null
IGL01161:Slc30a7 APN 3 115954110 missense possibly damaging 0.54
IGL01360:Slc30a7 APN 3 115990116 missense probably damaging 1.00
IGL02573:Slc30a7 APN 3 115990147 splice site probably benign
R0833:Slc30a7 UTSW 3 115990140 critical splice acceptor site probably null
R0836:Slc30a7 UTSW 3 115990140 critical splice acceptor site probably null
R1381:Slc30a7 UTSW 3 115956870 critical splice donor site probably null
R2445:Slc30a7 UTSW 3 115978653 missense probably damaging 1.00
R4072:Slc30a7 UTSW 3 115946680 missense probably damaging 0.96
R5429:Slc30a7 UTSW 3 116006925 missense possibly damaging 0.90
R5586:Slc30a7 UTSW 3 115990051 missense probably benign 0.36
R6170:Slc30a7 UTSW 3 115990743 missense probably damaging 1.00
R6813:Slc30a7 UTSW 3 115981811 missense probably benign 0.01
R6889:Slc30a7 UTSW 3 115954153 missense probably damaging 1.00
R8445:Slc30a7 UTSW 3 116007346 unclassified probably benign
R8872:Slc30a7 UTSW 3 115946668 missense possibly damaging 0.69
X0023:Slc30a7 UTSW 3 115990025 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGGAAGTTAACAGGTCACCC -3'
(R):5'- GGGCTTTCGTTAGCAGGATC -3'

Sequencing Primer
(F):5'- AGTCTCAGGAGCTCAGACC -3'
(R):5'- CTTTCGTTAGCAGGATCTTTCTG -3'
Posted On 2016-03-01