Incidental Mutation 'R4861:Slco1b2'
ID374295
Institutional Source Beutler Lab
Gene Symbol Slco1b2
Ensembl Gene ENSMUSG00000030236
Gene Namesolute carrier organic anion transporter family, member 1b2
Synonyms7330442B20Rik, Slc21a6, mlst-1, Oatp1b2, Slc21a10
MMRRC Submission 042472-MU
Accession Numbers

Genbank: NM_020495; MGI: 

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4861 (G1)
Quality Score186
Status Not validated
Chromosome6
Chromosomal Location141629518-141686646 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 141671222 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 427 (N427I)
Ref Sequence ENSEMBL: ENSMUSP00000044326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042812] [ENSMUST00000203597]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042812
AA Change: N427I

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000044326
Gene: ENSMUSG00000030236
AA Change: N427I

DomainStartEndE-ValueType
Pfam:MFS_1 27 443 6.1e-21 PFAM
KAZAL 457 501 8.81e-4 SMART
transmembrane domain 620 642 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203597
SMART Domains Protein: ENSMUSP00000144747
Gene: ENSMUSG00000030236

DomainStartEndE-ValueType
Pfam:MFS_1 27 405 8.4e-19 PFAM
KAZAL 422 466 5.7e-6 SMART
transmembrane domain 497 519 N/A INTRINSIC
transmembrane domain 534 556 N/A INTRINSIC
transmembrane domain 585 607 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 87.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a liver-specific member of the organic anion transporter family. The encoded protein is a transmembrane receptor that mediates the sodium-independent uptake of endogenous and xenobiotic compounds and plays a critical role in bile acid and bilirubin transport. Mutations in this gene are a cause of Rotor type hyperbilirubinemia. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null mutation display slight abnormalities in blood chemistry and are resistant to injury induced by some classes of hepatotoxins. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,245,905 R1153H probably damaging Het
Ahcy T C 2: 155,060,516 E411G probably benign Het
Alpi T A 1: 87,100,469 I211F probably damaging Het
Arfgef3 G A 10: 18,607,731 A1415V probably benign Het
Bora T C 14: 99,047,474 probably null Het
Car3 T C 3: 14,866,896 V109A probably damaging Het
Ccdc114 A G 7: 45,942,873 E359G probably damaging Het
Cdk13 A T 13: 17,766,586 V17D probably damaging Het
Cept1 A C 3: 106,505,732 S226A probably damaging Het
Dbt A T 3: 116,548,078 I443L probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Farp2 T C 1: 93,605,419 L633S probably damaging Het
Gm26727 T C 2: 67,432,945 I79M probably damaging Het
Gm5800 T A 14: 51,716,047 N37I probably damaging Het
Hapln1 G A 13: 89,601,452 G39S possibly damaging Het
Ice2 T A 9: 69,415,448 S408R probably benign Het
Lctl T C 9: 64,119,763 I131T possibly damaging Het
Ncoa7 T A 10: 30,704,612 M117L probably benign Het
Npy4r C T 14: 34,146,883 W149* probably null Het
Nr5a2 A G 1: 136,948,720 probably null Het
Plg G A 17: 12,395,735 E301K probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Rapgef2 T C 3: 79,074,436 K1084R probably benign Het
Slc41a2 T C 10: 83,316,458 Q51R probably damaging Het
Slc47a2 A T 11: 61,336,233 C170S probably benign Het
Smc2 G A 4: 52,461,090 R571H probably benign Het
Sp4 G T 12: 118,300,811 probably null Het
Tas2r117 T C 6: 132,803,129 F77L probably benign Het
Tbcd C T 11: 121,601,961 R875C probably damaging Het
Thumpd2 A G 17: 81,026,801 S453P probably benign Het
Vars2 G T 17: 35,661,933 Q13K probably benign Het
Other mutations in Slco1b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Slco1b2 APN 6 141655352 missense probably damaging 0.99
IGL01583:Slco1b2 APN 6 141663672 missense possibly damaging 0.85
IGL01909:Slco1b2 APN 6 141648586 missense probably damaging 1.00
IGL01943:Slco1b2 APN 6 141676286 missense possibly damaging 0.71
IGL01952:Slco1b2 APN 6 141671230 missense probably benign 0.01
IGL02186:Slco1b2 APN 6 141634545 splice site probably benign
IGL02309:Slco1b2 APN 6 141672281 missense probably damaging 1.00
IGL02352:Slco1b2 APN 6 141685525 missense probably damaging 0.96
IGL02359:Slco1b2 APN 6 141685525 missense probably damaging 0.96
IGL02524:Slco1b2 APN 6 141671072 missense probably benign 0.03
IGL02701:Slco1b2 APN 6 141685545 missense probably benign 0.35
IGL02962:Slco1b2 APN 6 141648553 missense probably damaging 0.99
3-1:Slco1b2 UTSW 6 141669463 missense probably benign 0.01
IGL03052:Slco1b2 UTSW 6 141648585 missense probably benign 0.13
R0112:Slco1b2 UTSW 6 141671111 missense probably benign 0.30
R0116:Slco1b2 UTSW 6 141669388 missense probably benign 0.22
R0515:Slco1b2 UTSW 6 141669410 missense possibly damaging 0.74
R0831:Slco1b2 UTSW 6 141685446 missense probably benign 0.01
R0965:Slco1b2 UTSW 6 141685596 missense probably damaging 1.00
R1115:Slco1b2 UTSW 6 141683254 missense probably benign 0.03
R1452:Slco1b2 UTSW 6 141672200 missense probably benign 0.02
R1630:Slco1b2 UTSW 6 141656821 missense probably damaging 0.99
R1885:Slco1b2 UTSW 6 141683225 missense probably damaging 0.96
R1886:Slco1b2 UTSW 6 141683225 missense probably damaging 0.96
R1975:Slco1b2 UTSW 6 141683225 missense probably damaging 0.96
R2394:Slco1b2 UTSW 6 141669374 missense probably damaging 0.99
R3408:Slco1b2 UTSW 6 141676256 missense probably benign 0.01
R3793:Slco1b2 UTSW 6 141676307 missense probably damaging 1.00
R4560:Slco1b2 UTSW 6 141671167 missense probably benign 0.15
R4561:Slco1b2 UTSW 6 141671167 missense probably benign 0.15
R4563:Slco1b2 UTSW 6 141671167 missense probably benign 0.15
R4807:Slco1b2 UTSW 6 141669469 missense probably damaging 1.00
R4820:Slco1b2 UTSW 6 141685432 missense probably benign 0.05
R4861:Slco1b2 UTSW 6 141671222 missense possibly damaging 0.95
R4889:Slco1b2 UTSW 6 141656743 intron probably benign
R4914:Slco1b2 UTSW 6 141669370 missense probably benign 0.14
R4918:Slco1b2 UTSW 6 141669370 missense probably benign 0.14
R4977:Slco1b2 UTSW 6 141657557 missense probably benign 0.01
R5607:Slco1b2 UTSW 6 141685586 missense probably benign
R6082:Slco1b2 UTSW 6 141663670 missense probably benign 0.08
R6118:Slco1b2 UTSW 6 141657510 missense probably benign 0.03
R6522:Slco1b2 UTSW 6 141655419 critical splice donor site probably null
R7054:Slco1b2 UTSW 6 141672248 missense probably damaging 1.00
R7182:Slco1b2 UTSW 6 141656930 missense probably damaging 1.00
R7763:Slco1b2 UTSW 6 141676224 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTAAAGACAGCAGAGAAGTCTTTC -3'
(R):5'- TGCTCTTGGGAGATCTTAAACAGTG -3'

Sequencing Primer
(F):5'- CCACTATGGCAAGTGGAA -3'
(R):5'- GGAAACTGTTTTCAGCCT -3'
Posted On2016-03-01