Incidental Mutation 'R4861:Ice2'
ID374299
Institutional Source Beutler Lab
Gene Symbol Ice2
Ensembl Gene ENSMUSG00000032235
Gene Nameinteractor of little elongation complex ELL subunit 2
SynonymsNarg2, B230343B06Rik
MMRRC Submission 042472-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.791) question?
Stock #R4861 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location69397906-69433122 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69415448 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 408 (S408R)
Ref Sequence ENSEMBL: ENSMUSP00000034761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034761]
Predicted Effect probably benign
Transcript: ENSMUST00000034761
AA Change: S408R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034761
Gene: ENSMUSG00000032235
AA Change: S408R

DomainStartEndE-ValueType
low complexity region 408 422 N/A INTRINSIC
low complexity region 434 473 N/A INTRINSIC
low complexity region 563 580 N/A INTRINSIC
low complexity region 615 629 N/A INTRINSIC
Pfam:NARG2_C 726 936 1.7e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147558
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 87.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,245,905 R1153H probably damaging Het
Ahcy T C 2: 155,060,516 E411G probably benign Het
Alpi T A 1: 87,100,469 I211F probably damaging Het
Arfgef3 G A 10: 18,607,731 A1415V probably benign Het
Bora T C 14: 99,047,474 probably null Het
Car3 T C 3: 14,866,896 V109A probably damaging Het
Ccdc114 A G 7: 45,942,873 E359G probably damaging Het
Cdk13 A T 13: 17,766,586 V17D probably damaging Het
Cept1 A C 3: 106,505,732 S226A probably damaging Het
Dbt A T 3: 116,548,078 I443L probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Farp2 T C 1: 93,605,419 L633S probably damaging Het
Gm26727 T C 2: 67,432,945 I79M probably damaging Het
Gm5800 T A 14: 51,716,047 N37I probably damaging Het
Hapln1 G A 13: 89,601,452 G39S possibly damaging Het
Lctl T C 9: 64,119,763 I131T possibly damaging Het
Ncoa7 T A 10: 30,704,612 M117L probably benign Het
Npy4r C T 14: 34,146,883 W149* probably null Het
Nr5a2 A G 1: 136,948,720 probably null Het
Plg G A 17: 12,395,735 E301K probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Rapgef2 T C 3: 79,074,436 K1084R probably benign Het
Slc41a2 T C 10: 83,316,458 Q51R probably damaging Het
Slc47a2 A T 11: 61,336,233 C170S probably benign Het
Slco1b2 A T 6: 141,671,222 N427I possibly damaging Het
Smc2 G A 4: 52,461,090 R571H probably benign Het
Sp4 G T 12: 118,300,811 probably null Het
Tas2r117 T C 6: 132,803,129 F77L probably benign Het
Tbcd C T 11: 121,601,961 R875C probably damaging Het
Thumpd2 A G 17: 81,026,801 S453P probably benign Het
Vars2 G T 17: 35,661,933 Q13K probably benign Het
Other mutations in Ice2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Ice2 APN 9 69416113 missense probably benign 0.04
IGL01626:Ice2 APN 9 69407332 missense probably benign 0.39
IGL03035:Ice2 APN 9 69425688 missense probably benign 0.06
R0227:Ice2 UTSW 9 69412228 missense probably benign 0.08
R1373:Ice2 UTSW 9 69407119 missense probably benign 0.01
R1381:Ice2 UTSW 9 69400527 missense probably damaging 1.00
R1599:Ice2 UTSW 9 69411442 missense probably null 0.01
R1778:Ice2 UTSW 9 69415648 missense probably benign 0.04
R1818:Ice2 UTSW 9 69432101 missense probably benign 0.00
R1829:Ice2 UTSW 9 69407353 missense probably damaging 0.99
R1876:Ice2 UTSW 9 69415575 missense possibly damaging 0.85
R1878:Ice2 UTSW 9 69428576 critical splice donor site probably null
R2026:Ice2 UTSW 9 69416325 missense probably benign 0.00
R2915:Ice2 UTSW 9 69410840 missense probably benign 0.19
R4097:Ice2 UTSW 9 69421671 missense possibly damaging 0.95
R4815:Ice2 UTSW 9 69407118 missense probably damaging 1.00
R4861:Ice2 UTSW 9 69415448 missense probably benign 0.00
R5066:Ice2 UTSW 9 69408291 missense probably benign 0.00
R5653:Ice2 UTSW 9 69428380 missense probably benign 0.00
R5898:Ice2 UTSW 9 69408262 missense probably benign 0.08
R5951:Ice2 UTSW 9 69412369 missense possibly damaging 0.67
R6176:Ice2 UTSW 9 69417072 missense probably damaging 1.00
R6566:Ice2 UTSW 9 69416229 missense probably benign
R6632:Ice2 UTSW 9 69428452 missense probably benign 0.07
R7195:Ice2 UTSW 9 69428500 missense possibly damaging 0.91
R7272:Ice2 UTSW 9 69417083 missense possibly damaging 0.46
R7365:Ice2 UTSW 9 69400512 missense probably damaging 1.00
R7495:Ice2 UTSW 9 69416229 missense probably benign 0.01
R7535:Ice2 UTSW 9 69432078 missense probably damaging 0.98
R7937:Ice2 UTSW 9 69410785 missense possibly damaging 0.71
R8124:Ice2 UTSW 9 69400495 missense probably damaging 1.00
R8381:Ice2 UTSW 9 69410171 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATTAAGTAACTATGACCTGAC -3'
(R):5'- CCAGAGAATAGCTGTTTCTCCTTC -3'

Sequencing Primer
(F):5'- AAGTAACTATGACCTGACTTTTCCC -3'
(R):5'- CTGATGCCTCAGGTGTAGC -3'
Posted On2016-03-01