Incidental Mutation 'R4861:Thumpd2'
ID374313
Institutional Source Beutler Lab
Gene Symbol Thumpd2
Ensembl Gene ENSMUSG00000024246
Gene NameTHUMP domain containing 2
Synonyms
MMRRC Submission 042472-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R4861 (G1)
Quality Score186
Status Not validated
Chromosome17
Chromosomal Location81026327-81065085 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81026801 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 453 (S453P)
Ref Sequence ENSEMBL: ENSMUSP00000025093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025093]
Predicted Effect probably benign
Transcript: ENSMUST00000025093
AA Change: S453P

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000025093
Gene: ENSMUSG00000024246
AA Change: S453P

DomainStartEndE-ValueType
THUMP 175 266 4.08e-2 SMART
Pfam:UPF0020 272 425 3e-27 PFAM
Pfam:CMAS 284 429 3e-7 PFAM
Pfam:Ubie_methyltran 285 417 3e-10 PFAM
Pfam:MTS 289 417 2.1e-7 PFAM
Pfam:Methyltransf_31 296 441 7.8e-14 PFAM
Pfam:Methyltransf_11 303 406 1.9e-10 PFAM
Meta Mutation Damage Score 0.1221 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 87.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,245,905 R1153H probably damaging Het
Ahcy T C 2: 155,060,516 E411G probably benign Het
Alpi T A 1: 87,100,469 I211F probably damaging Het
Arfgef3 G A 10: 18,607,731 A1415V probably benign Het
Bora T C 14: 99,047,474 probably null Het
Car3 T C 3: 14,866,896 V109A probably damaging Het
Ccdc114 A G 7: 45,942,873 E359G probably damaging Het
Cdk13 A T 13: 17,766,586 V17D probably damaging Het
Cept1 A C 3: 106,505,732 S226A probably damaging Het
Dbt A T 3: 116,548,078 I443L probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Farp2 T C 1: 93,605,419 L633S probably damaging Het
Gm26727 T C 2: 67,432,945 I79M probably damaging Het
Gm5800 T A 14: 51,716,047 N37I probably damaging Het
Hapln1 G A 13: 89,601,452 G39S possibly damaging Het
Ice2 T A 9: 69,415,448 S408R probably benign Het
Lctl T C 9: 64,119,763 I131T possibly damaging Het
Ncoa7 T A 10: 30,704,612 M117L probably benign Het
Npy4r C T 14: 34,146,883 W149* probably null Het
Nr5a2 A G 1: 136,948,720 probably null Het
Plg G A 17: 12,395,735 E301K probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Rapgef2 T C 3: 79,074,436 K1084R probably benign Het
Slc41a2 T C 10: 83,316,458 Q51R probably damaging Het
Slc47a2 A T 11: 61,336,233 C170S probably benign Het
Slco1b2 A T 6: 141,671,222 N427I possibly damaging Het
Smc2 G A 4: 52,461,090 R571H probably benign Het
Sp4 G T 12: 118,300,811 probably null Het
Tas2r117 T C 6: 132,803,129 F77L probably benign Het
Tbcd C T 11: 121,601,961 R875C probably damaging Het
Vars2 G T 17: 35,661,933 Q13K probably benign Het
Other mutations in Thumpd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01750:Thumpd2 APN 17 81054386 missense probably benign 0.00
IGL02409:Thumpd2 APN 17 81032688 missense probably damaging 1.00
IGL02546:Thumpd2 APN 17 81054455 missense probably benign 0.16
IGL03357:Thumpd2 APN 17 81044090 splice site probably benign
R1295:Thumpd2 UTSW 17 81055888 missense probably damaging 1.00
R2030:Thumpd2 UTSW 17 81064958 missense probably damaging 1.00
R2898:Thumpd2 UTSW 17 81044128 nonsense probably null
R4805:Thumpd2 UTSW 17 81026701 missense probably damaging 0.98
R4861:Thumpd2 UTSW 17 81026801 missense probably benign 0.03
R5328:Thumpd2 UTSW 17 81044162 missense possibly damaging 0.64
R5359:Thumpd2 UTSW 17 81026777 missense probably benign 0.16
R6207:Thumpd2 UTSW 17 81055837 missense probably damaging 1.00
R6218:Thumpd2 UTSW 17 81052913 missense probably damaging 1.00
R6484:Thumpd2 UTSW 17 81054188 missense probably benign 0.01
R6853:Thumpd2 UTSW 17 81065030 missense possibly damaging 0.75
R6855:Thumpd2 UTSW 17 81044170 missense probably damaging 1.00
R6917:Thumpd2 UTSW 17 81044114 missense probably benign 0.00
R7018:Thumpd2 UTSW 17 81055897 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGCTCATGGCATTCAGCTG -3'
(R):5'- GTCTCGGAACATAGAAACCCTC -3'

Sequencing Primer
(F):5'- TCATGGCATTCAGCTGAGGAC -3'
(R):5'- ATTTTTGTCACAGAGTGCTGC -3'
Posted On2016-03-01