Incidental Mutation 'R4879:Itgb5'
ID375167
Institutional Source Beutler Lab
Gene Symbol Itgb5
Ensembl Gene ENSMUSG00000022817
Gene Nameintegrin beta 5
SynonymsESTM23, [b]-5, beta-5, beta5, [b]5, [b]5A, [b]5B
MMRRC Submission 042488-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4879 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location33829665-33949338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 33875978 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 180 (G180R)
Ref Sequence ENSEMBL: ENSMUSP00000110680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069345] [ENSMUST00000115028]
Predicted Effect probably damaging
Transcript: ENSMUST00000069345
AA Change: G180R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069416
Gene: ENSMUSG00000022817
AA Change: G180R

DomainStartEndE-ValueType
PSI 27 76 1.4e-7 SMART
INB 35 463 1.18e-284 SMART
VWA 137 372 5.95e-7 SMART
internal_repeat_1 492 549 3.16e-7 PROSPERO
EGF 554 586 1.95e1 SMART
Integrin_B_tail 635 719 1.56e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115028
AA Change: G180R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110680
Gene: ENSMUSG00000022817
AA Change: G180R

DomainStartEndE-ValueType
PSI 27 76 1.4e-7 SMART
INB 35 463 1.18e-284 SMART
VWA 137 372 5.95e-7 SMART
internal_repeat_1 492 549 3.16e-7 PROSPERO
EGF 554 586 1.95e1 SMART
Integrin_B_tail 635 719 1.56e-21 SMART
Integrin_b_cyt 743 790 5.97e-18 SMART
Meta Mutation Damage Score 0.9686 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 97% (86/89)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation do not appear to differ from normal in respect to development, reproduction, adenovirus infection, or wound healing. Mutant keratinocytes do show reduced migration on, and adhesion to, vitronectin in vitro. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T A 11: 110,219,700 Y541F probably damaging Het
Acot12 T A 13: 91,762,964 V136E probably benign Het
Aftph A G 11: 20,698,311 probably null Het
Ambra1 C T 2: 91,772,694 probably benign Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Ano9 T C 7: 141,110,502 D73G probably benign Het
Asap3 G A 4: 136,242,664 D778N probably benign Het
Atp8a2 G T 14: 60,008,469 Y591* probably null Het
BC067074 T C 13: 113,319,787 I789T probably benign Het
Blk T C 14: 63,375,965 T365A probably benign Het
C4b G T 17: 34,743,647 S27Y probably damaging Het
C6 G T 15: 4,803,647 probably null Het
Ccdc33 T A 9: 58,067,556 I345F possibly damaging Het
Cetn3 T A 13: 81,792,149 probably benign Het
Cntn3 T A 6: 102,267,428 I387L possibly damaging Het
Cog8 A G 8: 107,056,352 C102R probably damaging Het
Cyp2c55 CA C 19: 39,042,078 probably null Het
Dmxl1 C T 18: 49,889,467 A1624V probably damaging Het
Dnah1 T G 14: 31,300,748 E1144A possibly damaging Het
Dnah12 T A 14: 26,718,046 probably null Het
Dnah2 G A 11: 69,476,691 T1794I probably damaging Het
Erbin A T 13: 103,834,774 M778K probably benign Het
Fam189a2 T C 19: 23,975,655 probably null Het
Fbxw10 G T 11: 62,847,747 A156S probably damaging Het
Flnc T A 6: 29,460,806 F2632Y probably damaging Het
Frmd4a A G 2: 4,529,817 K160E probably damaging Het
Glipr1l2 A G 10: 112,107,124 K295E probably benign Het
Gm10651 T C 7: 27,949,343 noncoding transcript Het
Gm15292 T A 8: 21,250,364 L62Q probably damaging Het
Gm7257 G A 9: 36,432,793 C24Y probably damaging Het
Herc1 T A 9: 66,462,837 C465* probably null Het
Hoxb4 A G 11: 96,320,188 I205V probably damaging Het
Ikbke GCC G 1: 131,275,267 probably null Het
Il1f6 A G 2: 24,216,020 N29S probably benign Het
Ilk A G 7: 105,741,804 S292G probably benign Het
Kcnip4 T C 5: 48,409,865 D120G possibly damaging Het
Kin A G 2: 10,080,644 D5G probably benign Het
Lrrtm2 C A 18: 35,213,319 G310V probably damaging Het
Med1 T C 11: 98,155,360 probably benign Het
Mepce C A 5: 137,785,282 probably benign Het
Nckipsd T A 9: 108,813,915 probably benign Het
Notch3 T A 17: 32,147,963 Q866L probably benign Het
Olfr1051 A T 2: 86,275,763 C241* probably null Het
Olfr1157 A T 2: 87,962,696 H65Q possibly damaging Het
Olfr547 A T 7: 102,534,755 T3S probably benign Het
Orai1 T C 5: 123,011,831 probably benign Het
Pcdhb8 A T 18: 37,356,166 E299V probably damaging Het
Pcnx4 G A 12: 72,567,185 D635N probably damaging Het
Pex5 T C 6: 124,398,363 I567V probably benign Het
Ppfibp2 T C 7: 107,729,183 S485P probably benign Het
Pqlc2 A T 4: 139,301,784 probably null Het
Sbno1 T C 5: 124,404,024 Y356C probably damaging Het
Sdcbp T C 4: 6,381,056 I67T possibly damaging Het
Slc5a7 A G 17: 54,276,651 I537T probably benign Het
Smad4 A G 18: 73,641,903 C442R probably damaging Het
Smpd5 A G 15: 76,294,870 H146R possibly damaging Het
Snai2 A G 16: 14,706,741 Y37C probably benign Het
Snapc4 C T 2: 26,365,992 S840N possibly damaging Het
Stpg2 T C 3: 139,215,373 I113T probably benign Het
Tbc1d32 T C 10: 56,049,029 probably null Het
Tfg A T 16: 56,701,157 S39R probably damaging Het
Thsd7b T A 1: 130,188,499 S1330T possibly damaging Het
Tnfaip3 T C 10: 19,005,573 T322A probably benign Het
Tpra1 A G 6: 88,911,709 Y291C probably damaging Het
Trcg1 A G 9: 57,246,720 D658G probably damaging Het
Trip4 C T 9: 65,875,022 V143I probably benign Het
Trp53bp1 T C 2: 121,202,603 K1691E probably damaging Het
Ttc8 T A 12: 98,942,303 M77K possibly damaging Het
Tubb2a A T 13: 34,074,589 M406K probably benign Het
Txnrd1 T A 10: 82,881,917 probably null Het
Ugt2a3 C A 5: 87,331,285 R268L probably benign Het
Usp34 T G 11: 23,373,410 M982R possibly damaging Het
Vmn2r43 T A 7: 8,255,103 K370N probably benign Het
Vopp1 A T 6: 57,762,370 probably benign Het
Vps11 A C 9: 44,353,300 C660G probably benign Het
Wnk1 T C 6: 119,949,377 H1137R probably damaging Het
Wtap A G 17: 12,969,435 Y193H probably damaging Het
Zfp462 T A 4: 55,009,444 V470D probably benign Het
Other mutations in Itgb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Itgb5 APN 16 33884975 missense probably damaging 1.00
IGL01121:Itgb5 APN 16 33919989 missense probably benign 0.00
IGL01620:Itgb5 APN 16 33919798 missense probably damaging 1.00
IGL02332:Itgb5 APN 16 33920130 nonsense probably null
IGL02869:Itgb5 APN 16 33844992 missense possibly damaging 0.94
IGL02881:Itgb5 APN 16 33919905 missense probably benign 0.00
IGL02941:Itgb5 APN 16 33944095 splice site probably benign
IGL03216:Itgb5 APN 16 33902838 missense probably benign 0.38
IGL03351:Itgb5 APN 16 33910552 missense probably benign 0.00
PIT4812001:Itgb5 UTSW 16 33919987 missense probably damaging 1.00
R0744:Itgb5 UTSW 16 33900583 missense probably damaging 0.99
R0829:Itgb5 UTSW 16 33944201 missense probably benign 0.29
R0836:Itgb5 UTSW 16 33900583 missense probably damaging 0.99
R1387:Itgb5 UTSW 16 33900515 nonsense probably null
R1703:Itgb5 UTSW 16 33910500 missense probably benign 0.01
R1783:Itgb5 UTSW 16 33940562 missense probably benign 0.13
R1826:Itgb5 UTSW 16 33865560 missense possibly damaging 0.48
R1889:Itgb5 UTSW 16 33910469 missense probably damaging 1.00
R2374:Itgb5 UTSW 16 33919798 missense probably damaging 1.00
R4307:Itgb5 UTSW 16 33948732 missense possibly damaging 0.80
R4355:Itgb5 UTSW 16 33844997 missense probably damaging 0.98
R4796:Itgb5 UTSW 16 33885021 missense possibly damaging 0.83
R6165:Itgb5 UTSW 16 33899242 missense probably benign 0.01
R6584:Itgb5 UTSW 16 33885030 missense probably damaging 1.00
R6617:Itgb5 UTSW 16 33946592 missense probably benign 0.01
R6748:Itgb5 UTSW 16 33899297 missense probably damaging 1.00
R6979:Itgb5 UTSW 16 33919986 missense probably damaging 1.00
R7090:Itgb5 UTSW 16 33885094 missense probably damaging 1.00
R7150:Itgb5 UTSW 16 33940643 missense probably benign 0.03
R7403:Itgb5 UTSW 16 33902793 critical splice acceptor site probably null
R7418:Itgb5 UTSW 16 33885094 missense probably damaging 1.00
R7719:Itgb5 UTSW 16 33920116 missense probably benign 0.01
X0022:Itgb5 UTSW 16 33845050 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AGCAGACTACGTTCCAGCTG -3'
(R):5'- TTCACTTTGTCACATGTAGGGC -3'

Sequencing Primer
(F):5'- ACTACGTTCCAGCTGCAGGTG -3'
(R):5'- GTGGCCATCACGAATCATTAAATAC -3'
Posted On2016-03-17