Incidental Mutation 'R6584:Itgb5'
ID 524301
Institutional Source Beutler Lab
Gene Symbol Itgb5
Ensembl Gene ENSMUSG00000022817
Gene Name integrin beta 5
Synonyms ESTM23, [b]-5, beta-5, beta5, [b]5, [b]5A, [b]5B
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6584 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 33829665-33949338 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 33885030 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 230 (F230S)
Ref Sequence ENSEMBL: ENSMUSP00000110680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069345] [ENSMUST00000115028]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000069345
AA Change: F230S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069416
Gene: ENSMUSG00000022817
AA Change: F230S

DomainStartEndE-ValueType
PSI 27 76 1.4e-7 SMART
INB 35 463 1.18e-284 SMART
VWA 137 372 5.95e-7 SMART
internal_repeat_1 492 549 3.16e-7 PROSPERO
EGF 554 586 1.95e1 SMART
Integrin_B_tail 635 719 1.56e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115028
AA Change: F230S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110680
Gene: ENSMUSG00000022817
AA Change: F230S

DomainStartEndE-ValueType
PSI 27 76 1.4e-7 SMART
INB 35 463 1.18e-284 SMART
VWA 137 372 5.95e-7 SMART
internal_repeat_1 492 549 3.16e-7 PROSPERO
EGF 554 586 1.95e1 SMART
Integrin_B_tail 635 719 1.56e-21 SMART
Integrin_b_cyt 743 790 5.97e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134262
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation do not appear to differ from normal in respect to development, reproduction, adenovirus infection, or wound healing. Mutant keratinocytes do show reduced migration on, and adhesion to, vitronectin in vitro. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,718,728 N1122D possibly damaging Het
Agr2 G A 12: 35,995,626 R37Q probably benign Het
Amfr T C 8: 93,974,155 D559G probably benign Het
Atg2b T C 12: 105,657,995 Y711C probably damaging Het
Clgn T C 8: 83,400,036 I122T probably benign Het
Ets1 T A 9: 32,733,997 F180Y probably damaging Het
Fbxw14 C G 9: 109,286,543 C53S possibly damaging Het
Gm13088 T A 4: 143,655,470 T219S possibly damaging Het
Ifna9 A G 4: 88,592,138 L83P probably damaging Het
Igf2r A G 17: 12,701,250 C1401R probably damaging Het
Il22 A T 10: 118,205,027 M13L probably benign Het
Il9r A G 11: 32,191,782 Y319H probably benign Het
Klk1b27 T A 7: 44,054,511 I26N possibly damaging Het
Lrba C T 3: 86,664,576 R300C probably damaging Het
Map3k4 A C 17: 12,260,491 Y730D probably damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Paxip1 G A 5: 27,758,452 H792Y probably damaging Het
Phf20 T C 2: 156,294,123 S621P probably damaging Het
Slitrk3 C A 3: 73,049,225 G738V probably damaging Het
Smurf1 T C 5: 144,882,523 D598G probably damaging Het
St6galnac2 A G 11: 116,694,504 S19P probably benign Het
Stra6l G A 4: 45,869,635 probably null Het
Tbc1d9 C A 8: 83,261,000 Q863K probably damaging Het
Traf1 T A 2: 34,958,058 D8V probably damaging Het
Vmn2r24 T G 6: 123,815,805 M697R possibly damaging Het
Wdr27 T A 17: 14,901,769 Y625F probably damaging Het
Wdr49 T C 3: 75,337,758 M339V probably benign Het
Other mutations in Itgb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Itgb5 APN 16 33884975 missense probably damaging 1.00
IGL01121:Itgb5 APN 16 33919989 missense probably benign 0.00
IGL01620:Itgb5 APN 16 33919798 missense probably damaging 1.00
IGL02332:Itgb5 APN 16 33920130 nonsense probably null
IGL02869:Itgb5 APN 16 33844992 missense possibly damaging 0.94
IGL02881:Itgb5 APN 16 33919905 missense probably benign 0.00
IGL02941:Itgb5 APN 16 33944095 splice site probably benign
IGL03216:Itgb5 APN 16 33902838 missense probably benign 0.38
IGL03351:Itgb5 APN 16 33910552 missense probably benign 0.00
PIT4812001:Itgb5 UTSW 16 33919987 missense probably damaging 1.00
R0744:Itgb5 UTSW 16 33900583 missense probably damaging 0.99
R0829:Itgb5 UTSW 16 33944201 missense probably benign 0.29
R0836:Itgb5 UTSW 16 33900583 missense probably damaging 0.99
R1387:Itgb5 UTSW 16 33900515 nonsense probably null
R1703:Itgb5 UTSW 16 33910500 missense probably benign 0.01
R1783:Itgb5 UTSW 16 33940562 missense probably benign 0.13
R1826:Itgb5 UTSW 16 33865560 missense possibly damaging 0.48
R1889:Itgb5 UTSW 16 33910469 missense probably damaging 1.00
R2374:Itgb5 UTSW 16 33919798 missense probably damaging 1.00
R4307:Itgb5 UTSW 16 33948732 missense possibly damaging 0.80
R4355:Itgb5 UTSW 16 33844997 missense probably damaging 0.98
R4796:Itgb5 UTSW 16 33885021 missense possibly damaging 0.83
R4879:Itgb5 UTSW 16 33875978 missense probably damaging 1.00
R6165:Itgb5 UTSW 16 33899242 missense probably benign 0.01
R6617:Itgb5 UTSW 16 33946592 missense probably benign 0.01
R6748:Itgb5 UTSW 16 33899297 missense probably damaging 1.00
R6979:Itgb5 UTSW 16 33919986 missense probably damaging 1.00
R7090:Itgb5 UTSW 16 33885094 missense probably damaging 1.00
R7150:Itgb5 UTSW 16 33940643 missense probably benign 0.03
R7403:Itgb5 UTSW 16 33902793 critical splice acceptor site probably null
R7418:Itgb5 UTSW 16 33885094 missense probably damaging 1.00
R7719:Itgb5 UTSW 16 33920116 missense probably benign 0.01
R8309:Itgb5 UTSW 16 33865553 missense probably benign 0.00
R8347:Itgb5 UTSW 16 33940678 missense probably damaging 1.00
R8856:Itgb5 UTSW 16 33900592 missense probably damaging 1.00
R9100:Itgb5 UTSW 16 33920181 missense possibly damaging 0.91
R9194:Itgb5 UTSW 16 33900511 missense probably damaging 1.00
R9309:Itgb5 UTSW 16 33920046 missense probably benign 0.00
R9343:Itgb5 UTSW 16 33910456 splice site probably benign
R9629:Itgb5 UTSW 16 33875925 missense probably damaging 1.00
R9683:Itgb5 UTSW 16 33919965 missense probably damaging 0.97
R9710:Itgb5 UTSW 16 33865547 missense probably benign 0.00
X0022:Itgb5 UTSW 16 33845050 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TACTTAGTGAAGGCCAGGACAG -3'
(R):5'- CTAGAGATTCCGCCATGGTG -3'

Sequencing Primer
(F):5'- GTGGCTCACAACCATCTGTAATGG -3'
(R):5'- ATGGTGCGGCTGAGCTCAG -3'
Posted On 2018-06-22