Incidental Mutation 'R4941:Hsd3b5'
ID 383062
Institutional Source Beutler Lab
Gene Symbol Hsd3b5
Ensembl Gene ENSMUSG00000038092
Gene Name hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 5
Synonyms 3(beta)HSDV
MMRRC Submission 042539-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.062) question?
Stock # R4941 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 98525950-98537568 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 98526379 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 356 (W356R)
Ref Sequence ENSEMBL: ENSMUSP00000041442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044094]
AlphaFold Q61694
Predicted Effect probably damaging
Transcript: ENSMUST00000044094
AA Change: W356R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041442
Gene: ENSMUSG00000038092
AA Change: W356R

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 4 261 1.8e-8 PFAM
Pfam:KR 5 133 3.2e-8 PFAM
Pfam:Polysacc_synt_2 6 134 5.9e-12 PFAM
Pfam:NmrA 6 147 2.7e-12 PFAM
Pfam:Epimerase 6 249 1.2e-23 PFAM
Pfam:GDP_Man_Dehyd 7 187 5.6e-12 PFAM
Pfam:3Beta_HSD 7 288 2e-105 PFAM
Pfam:NAD_binding_4 8 220 3.1e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196741
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.0%
Validation Efficiency 97% (112/116)
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt T A 15: 83,112,529 (GRCm39) I85F probably damaging Het
Abcc6 T A 7: 45,661,947 (GRCm39) I435F probably benign Het
Adam3 T C 8: 25,167,332 (GRCm39) probably benign Het
Adrb3 T C 8: 27,717,450 (GRCm39) Y333C probably damaging Het
Ago4 A T 4: 126,419,847 (GRCm39) D43E probably benign Het
Agt T A 8: 125,283,727 (GRCm39) Q464L probably benign Het
Amdhd1 A T 10: 93,367,463 (GRCm39) D230E probably damaging Het
Aplf A G 6: 87,645,405 (GRCm39) I33T probably damaging Het
Aplf A T 6: 87,623,331 (GRCm39) N249K probably benign Het
Arap2 A G 5: 62,906,821 (GRCm39) M66T probably benign Het
Atf4 T C 15: 80,140,434 (GRCm39) probably benign Het
Bahcc1 A C 11: 120,177,491 (GRCm39) H2068P probably benign Het
Bcor C T X: 11,906,725 (GRCm39) R1551Q probably damaging Het
Bltp1 A C 3: 36,971,851 (GRCm39) H528P probably damaging Het
Bltp1 G A 3: 36,974,050 (GRCm39) S600N probably benign Het
Catsper1 C A 19: 5,391,466 (GRCm39) A616D possibly damaging Het
Cdkn3 A G 14: 47,007,320 (GRCm39) D159G possibly damaging Het
Cep162 T C 9: 87,108,022 (GRCm39) probably benign Het
Clca3a1 T A 3: 144,721,414 (GRCm39) I386L probably damaging Het
Cldn10 G A 14: 119,025,725 (GRCm39) G53S possibly damaging Het
Cmtm3 T C 8: 105,070,460 (GRCm39) L73P probably damaging Het
Cnksr3 A C 10: 7,102,925 (GRCm39) L149R probably benign Het
Cope T C 8: 70,755,584 (GRCm39) probably null Het
Cpa6 T A 1: 10,479,562 (GRCm39) M224L probably benign Het
Cyp2d41-ps T C 15: 82,666,154 (GRCm39) noncoding transcript Het
Ddx55 T A 5: 124,706,779 (GRCm39) L592* probably null Het
Deup1 T C 9: 15,499,323 (GRCm39) M333V probably benign Het
Eif4a1 T C 11: 69,558,640 (GRCm39) probably benign Het
Eif4g3 A C 4: 137,897,876 (GRCm39) D1026A probably damaging Het
Eif5b T C 1: 38,090,280 (GRCm39) V1153A probably damaging Het
Ercc8 G T 13: 108,297,301 (GRCm39) probably benign Het
Fam227a C A 15: 79,524,204 (GRCm39) probably null Het
Fat1 A G 8: 45,489,312 (GRCm39) I3505V probably benign Het
Fat3 T G 9: 16,286,448 (GRCm39) E1025A probably damaging Het
Fat4 C T 3: 39,011,601 (GRCm39) R2234W probably damaging Het
Fer1l4 G T 2: 155,887,009 (GRCm39) F634L probably damaging Het
Fetub G A 16: 22,756,624 (GRCm39) V162I probably benign Het
Fgd4 T C 16: 16,302,402 (GRCm39) Q51R probably benign Het
Fgfr2 T C 7: 129,800,175 (GRCm39) H140R probably benign Het
Flt3 T A 5: 147,293,185 (GRCm39) probably null Het
Gabrb1 A G 5: 72,294,121 (GRCm39) N465S probably damaging Het
Gapdhs T C 7: 30,432,691 (GRCm39) I206V probably benign Het
Gkn3 C T 6: 87,360,507 (GRCm39) A163T probably damaging Het
Glp2r T C 11: 67,637,529 (GRCm39) probably null Het
Gm4956 T A 1: 21,368,306 (GRCm39) noncoding transcript Het
Gtf2a1l A T 17: 89,022,350 (GRCm39) D447V probably damaging Het
Idh2 A T 7: 79,745,847 (GRCm39) V335D probably damaging Het
Isyna1 T C 8: 71,048,146 (GRCm39) I184T probably damaging Het
Kcnh2 A G 5: 24,536,085 (GRCm39) S320P probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Kpna6 A G 4: 129,541,825 (GRCm39) F524S probably damaging Het
Lap3 A T 5: 45,663,539 (GRCm39) M338L probably benign Het
Lins1 T C 7: 66,359,198 (GRCm39) probably benign Het
Llgl1 C T 11: 60,600,394 (GRCm39) P581L probably benign Het
Lrrc43 A G 5: 123,639,126 (GRCm39) D385G probably benign Het
Maf T C 8: 116,433,532 (GRCm39) D24G unknown Het
Nell1 T C 7: 49,712,386 (GRCm39) S69P probably benign Het
Nkapd1 G T 9: 50,518,809 (GRCm39) Q268K probably benign Het
Or13p4 C T 4: 118,547,089 (GRCm39) V187I possibly damaging Het
Or2h1 C T 17: 37,404,484 (GRCm39) G94E probably damaging Het
Or2j6 T A 7: 139,980,792 (GRCm39) M56L probably benign Het
Or51af1 T C 7: 103,141,458 (GRCm39) D209G probably damaging Het
Or5an10 A G 19: 12,276,260 (GRCm39) S79P possibly damaging Het
Or8g54 T C 9: 39,707,160 (GRCm39) M163T possibly damaging Het
Oxld1 T C 11: 120,347,862 (GRCm39) T112A probably benign Het
Parp14 T C 16: 35,666,403 (GRCm39) N1210S probably benign Het
Pcdhb10 C A 18: 37,545,887 (GRCm39) T321K probably benign Het
Pcdhb8 C T 18: 37,489,059 (GRCm39) L246F probably benign Het
Pcdhga1 T A 18: 37,795,659 (GRCm39) I221K probably benign Het
Pcdhga9 T A 18: 37,871,185 (GRCm39) V338E probably damaging Het
Pdcd11 T C 19: 47,108,325 (GRCm39) S1231P probably damaging Het
Pde6c A T 19: 38,140,013 (GRCm39) L325F probably damaging Het
Pnpla7 T A 2: 24,887,276 (GRCm39) probably null Het
Pparg T A 6: 115,467,071 (GRCm39) V478E probably damaging Het
Ppib T C 9: 65,967,672 (GRCm39) V42A probably benign Het
Ppox T C 1: 171,105,166 (GRCm39) M341V probably damaging Het
Proc T C 18: 32,258,166 (GRCm39) K260E possibly damaging Het
Ptpro C T 6: 137,369,763 (GRCm39) P525L probably damaging Het
Rnf14 C A 18: 38,441,435 (GRCm39) A275E probably damaging Het
Scnn1b C T 7: 121,511,231 (GRCm39) P306L probably damaging Het
Sec14l5 A G 16: 4,994,364 (GRCm39) E386G probably damaging Het
Sftpa1 T A 14: 40,854,509 (GRCm39) I32N probably damaging Het
Slc26a5 A G 5: 22,025,384 (GRCm39) I408T probably damaging Het
Slc7a13 A G 4: 19,841,467 (GRCm39) Y438C probably damaging Het
Spire1 T C 18: 67,652,384 (GRCm39) E231G possibly damaging Het
Stab1 T A 14: 30,873,528 (GRCm39) I1014F probably benign Het
Steap2 T C 5: 5,727,651 (GRCm39) Y228C probably damaging Het
Tmem131l T C 3: 83,806,546 (GRCm39) T1487A probably benign Het
Tmem171 A G 13: 98,828,803 (GRCm39) F116L possibly damaging Het
Tmem215 T C 4: 40,474,520 (GRCm39) V199A probably damaging Het
Tmem45a T C 16: 56,642,652 (GRCm39) N173S possibly damaging Het
Uqcrc2 C T 7: 120,242,301 (GRCm39) R148C probably benign Het
Vmn2r116 A G 17: 23,620,116 (GRCm39) K617E probably damaging Het
Xrcc6 T C 15: 81,924,013 (GRCm39) L229P probably damaging Het
Yju2 A G 17: 56,271,149 (GRCm39) D97G possibly damaging Het
Zfp184 A G 13: 22,133,891 (GRCm39) D46G probably damaging Het
Zfp790 T A 7: 29,528,916 (GRCm39) C534S possibly damaging Het
Zfp990 A T 4: 145,263,407 (GRCm39) N135I probably damaging Het
Other mutations in Hsd3b5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Hsd3b5 APN 3 98,537,373 (GRCm39) missense probably benign 0.05
IGL00827:Hsd3b5 APN 3 98,537,414 (GRCm39) missense probably benign 0.00
IGL01530:Hsd3b5 APN 3 98,526,439 (GRCm39) missense probably damaging 1.00
IGL01930:Hsd3b5 APN 3 98,529,475 (GRCm39) missense probably benign 0.01
IGL02363:Hsd3b5 APN 3 98,537,421 (GRCm39) missense probably benign 0.08
IGL02396:Hsd3b5 APN 3 98,529,343 (GRCm39) missense probably benign 0.05
IGL02448:Hsd3b5 APN 3 98,529,447 (GRCm39) missense probably damaging 1.00
R0045:Hsd3b5 UTSW 3 98,526,460 (GRCm39) missense probably benign
R0624:Hsd3b5 UTSW 3 98,526,720 (GRCm39) missense probably damaging 0.98
R0745:Hsd3b5 UTSW 3 98,526,855 (GRCm39) missense probably benign 0.12
R0848:Hsd3b5 UTSW 3 98,526,671 (GRCm39) missense probably damaging 1.00
R1112:Hsd3b5 UTSW 3 98,537,393 (GRCm39) missense probably benign 0.00
R1454:Hsd3b5 UTSW 3 98,526,846 (GRCm39) missense probably benign 0.01
R1631:Hsd3b5 UTSW 3 98,529,393 (GRCm39) missense probably damaging 1.00
R1657:Hsd3b5 UTSW 3 98,527,036 (GRCm39) missense possibly damaging 0.89
R1839:Hsd3b5 UTSW 3 98,527,044 (GRCm39) missense probably benign 0.30
R2930:Hsd3b5 UTSW 3 98,526,528 (GRCm39) missense probably benign 0.03
R2982:Hsd3b5 UTSW 3 98,527,116 (GRCm39) missense possibly damaging 0.88
R3158:Hsd3b5 UTSW 3 98,529,375 (GRCm39) missense probably benign 0.00
R4573:Hsd3b5 UTSW 3 98,526,964 (GRCm39) missense probably benign 0.04
R5104:Hsd3b5 UTSW 3 98,526,592 (GRCm39) missense probably damaging 1.00
R5416:Hsd3b5 UTSW 3 98,526,466 (GRCm39) missense probably damaging 1.00
R6311:Hsd3b5 UTSW 3 98,537,406 (GRCm39) missense possibly damaging 0.79
R6861:Hsd3b5 UTSW 3 98,529,328 (GRCm39) missense probably damaging 1.00
R7307:Hsd3b5 UTSW 3 98,527,085 (GRCm39) missense probably damaging 0.97
R7339:Hsd3b5 UTSW 3 98,529,390 (GRCm39) missense probably damaging 1.00
R7615:Hsd3b5 UTSW 3 98,537,420 (GRCm39) missense probably damaging 0.99
R7673:Hsd3b5 UTSW 3 98,526,757 (GRCm39) missense probably damaging 1.00
R7883:Hsd3b5 UTSW 3 98,529,456 (GRCm39) missense probably benign 0.00
R8398:Hsd3b5 UTSW 3 98,526,720 (GRCm39) missense possibly damaging 0.85
R9218:Hsd3b5 UTSW 3 98,526,354 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGGGCAAGTGCTTAGGACTG -3'
(R):5'- GGAAACTGTGAGCTTCCTGC -3'

Sequencing Primer
(F):5'- GGTTGCTAGTGACCCAAAGAC -3'
(R):5'- GCTACGTCCAGTTTACAACTATAGGC -3'
Posted On 2016-04-27