Mutagenetix > Incidental Mutations

Incidental Mutation 'R7368:Lrp5'

571966

Institutional Source

Beutler Lab

Gene Symbol

Lrp5

Ensembl Gene

ENSMUSG00000024913

Gene Name

low density lipoprotein receptor-related protein 5

Synonyms

LR3, LRP7

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.910) question?

Stock #

R7368 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

3584828-3686564 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 3620085 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 673 (V673A)

Ref Sequence

ENSEMBL: ENSMUSP00000025856 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025856] [ENSMUST00000176867] [ENSMUST00000177294] [ENSMUST00000177330]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000025856
AA Change: V673A

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000025856
Gene: ENSMUSG00000024913
AA Change: V673A

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
LY	54	96	1.26e0	SMART
LY	99	141	2.11e-13	SMART
LY	142	185	1.32e-14	SMART
LY	186	228	1.6e-13	SMART
LY	229	270	4e-5	SMART
EGF	297	336	1.01e-1	SMART
LY	364	406	5.15e-8	SMART
LY	407	449	4.12e-16	SMART
LY	450	493	7.68e-16	SMART
LY	494	536	6.24e-16	SMART
LY	537	577	3.73e-5	SMART
EGF	603	640	2.48e-1	SMART
LY	666	708	5.92e-8	SMART
LY	709	751	5.65e-14	SMART
LY	752	795	3.81e-11	SMART
LY	796	837	3.54e-6	SMART
LY	838	877	1.33e-1	SMART
EGF	904	941	1.22e0	SMART
LY	968	1009	4.39e-2	SMART
LY	1015	1057	1.81e0	SMART
LY	1058	1102	9.47e-7	SMART
LY	1103	1145	6.91e-9	SMART
LY	1146	1186	1.53e0	SMART
EGF	1215	1253	2.85e-1	SMART
LDLa	1257	1296	1.23e-13	SMART
LDLa	1297	1333	3.26e-9	SMART
LDLa	1334	1371	1.31e-13	SMART
transmembrane domain	1384	1406	N/A	INTRINSIC
low complexity region	1494	1503	N/A	INTRINSIC
low complexity region	1571	1578	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176867

SMART Domains

Protein: ENSMUSP00000135654
Gene: ENSMUSG00000024913

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
LY	54	96	1.26e0	SMART
LY	99	141	2.11e-13	SMART
LY	142	185	1.32e-14	SMART
LY	186	228	1.6e-13	SMART
LY	229	270	4e-5	SMART
EGF	297	336	1.01e-1	SMART
LY	364	406	5.15e-8	SMART
LY	407	449	4.12e-16	SMART
LY	450	493	7.68e-16	SMART
LY	494	536	6.24e-16	SMART
LY	537	577	3.73e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000177294

SMART Domains

Protein: ENSMUSP00000134771
Gene: ENSMUSG00000024913

Domain	Start	End	E-Value	Type
LY	1	26	1.88e1	SMART
LY	27	70	3.81e-11	SMART
LY	71	112	3.54e-6	SMART
LY	113	152	1.33e-1	SMART
EGF	179	216	1.22e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000177330

SMART Domains

Protein: ENSMUSP00000134983
Gene: ENSMUSG00000024913

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
LY	54	96	1.26e0	SMART
LY	99	141	2.11e-13	SMART
LY	142	185	1.32e-14	SMART
LY	186	228	1.6e-13	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane low-density lipoprotein receptor that binds and internalizes ligands in the process of receptor-mediated endocytosis. This protein also acts as a co-receptor with Frizzled protein family members for transducing signals by Wnt proteins and was originally cloned on the basis of its association with type 1 diabetes mellitus in humans. This protein plays a key role in skeletal homeostasis and many bone density related diseases are caused by mutations in this gene. Mutations in this gene also cause familial exudative vitreoretinopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous mutants show variable bone loss, decreased osteoblast proliferation, impaired glucose tolerance, increased plasma cholesterol on high-fat diet and persistent embryonic eye vascularization, depending on allelic combination and strain background. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcd4	A	T	12: 84,612,865	F153I	possibly damaging	Het
Adcy1	G	A	11: 7,144,765	V564I	probably damaging	Het
Apol9b	T	C	15: 77,735,934	I310T	possibly damaging	Het
Arhgef28	C	A	13: 97,996,862	V366F	probably benign	Het
B020004C17Rik	C	T	14: 57,017,316	T199I	possibly damaging	Het
Carmil2	C	T	8: 105,690,835	T575I	possibly damaging	Het
Catsper1	A	T	19: 5,336,663	Q308L	unknown	Het
Cpa2	T	A	6: 30,551,990	S239T	probably damaging	Het
Ddit3	G	A	10: 127,295,907	G108D	probably damaging	Het
Dnah3	T	C	7: 120,029,016	I1473V	probably benign	Het
Dscam	A	G	16: 96,643,931	V1520A	probably benign	Het
Edc4	TAGTAGCAGCAGCAGTAGCAGCAGCAG	TAGTAGCAGCAGCAG	8: 105,888,405		probably benign	Het
Ednrb	T	A	14: 103,820,017	I370F	probably benign	Het
Ehd3	A	G	17: 73,827,462	E272G	possibly damaging	Het
Epha7	C	T	4: 28,871,937	S422L	probably benign	Het
Fam49b	A	T	15: 63,938,658		probably null	Het
Fkbp11	T	C	15: 98,724,426	K189E	unknown	Het
Frem1	T	A	4: 82,966,144	E1190D	probably benign	Het
Gabrg2	A	C	11: 41,976,563	Y76*	probably null	Het
Gm11437	T	A	11: 84,167,472		probably benign	Het
Gm8947	C	A	1: 151,193,096	Q227K	probably benign	Het
Gm9195	A	G	14: 72,480,056	F279S	probably damaging	Het
Gpbp1l1	T	C	4: 116,573,458	I42T	probably benign	Het
Hdac5	A	T	11: 102,197,381	V939E	probably null	Het
Hivep3	CGG	CG	4: 120,097,911		probably null	Het
Kitl	A	T	10: 100,016,081	I21F	probably benign	Het
Krt1	T	C	15: 101,846,872	D484G	probably damaging	Het
Larp1	C	A	11: 58,048,078	P527T	probably damaging	Het
Lrp6	G	T	6: 134,450,818	P1604T	probably damaging	Het
Mmp27	G	A	9: 7,577,317	V228M	probably damaging	Het
Ms4a6d	G	A	19: 11,590,073	Q155*	probably null	Het
Myo15	G	T	11: 60,490,915		probably null	Het
Myt1	A	G	2: 181,782,591	K26E	possibly damaging	Het
Nek1	T	A	8: 61,089,707	I777N	probably benign	Het
Nlrc5	C	T	8: 94,476,393	R374*	probably null	Het
Nol8	T	C	13: 49,661,219	S268P	probably benign	Het
Nynrin	T	A	14: 55,870,511	L1025Q	probably damaging	Het
Olfr1099	A	G	2: 86,959,258	S67P	probably damaging	Het
Osbpl3	A	T	6: 50,348,098	L140H	probably damaging	Het
Pcnt	T	C	10: 76,400,001	N1382S	probably benign	Het
Pef1	T	A	4: 130,127,385	L244*	probably null	Het
Phf11a	T	C	14: 59,280,725	E191G	probably benign	Het
Polr3a	A	T	14: 24,467,076	D702E	probably damaging	Het
Ptch1	C	T	13: 63,511,984	G1285D	probably benign	Het
Ptpn3	T	C	4: 57,221,993	D566G	probably damaging	Het
Pwp2	C	T	10: 78,182,480	G126R	probably damaging	Het
Scgb1b12	T	C	7: 32,334,567	I84T	probably damaging	Het
Sh2b1	A	T	7: 126,468,513	D618E	possibly damaging	Het
Slc35f5	T	A	1: 125,584,519	V352E	probably damaging	Het
Sppl2c	A	G	11: 104,187,604	E410G	probably damaging	Het
St6galnac2	T	C	11: 116,679,979	Y261C	probably damaging	Het
Stra6	G	A	9: 58,151,260	R468Q	probably benign	Het
Taf3	T	C	2: 9,916,377	H924R	unknown	Het
Tbx18	C	A	9: 87,730,697	V50L	probably benign	Het
Tgoln1	G	C	6: 72,616,278	T73R	probably benign	Het
Unc45b	C	T	11: 82,942,495	T845I	probably benign	Het
Usp15	T	C	10: 123,196,893	D8G	possibly damaging	Het
Vmn2r91	A	G	17: 18,136,278	I736V	possibly damaging	Het
Vps13c	C	A	9: 67,914,073	D1288E	probably benign	Het
Zfp458	T	A	13: 67,257,236	M380L	probably benign	Het
Zfp638	A	G	6: 83,929,455	N201D	possibly damaging	Het

Other mutations in Lrp5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00834:Lrp5	APN	19	3649404	missense	probably benign
IGL00902:Lrp5	APN	19	3600774	missense	probably damaging	1.00
IGL02032:Lrp5	APN	19	3615886	splice site	probably benign
IGL02331:Lrp5	APN	19	3591816	missense	possibly damaging	0.64
IGL02401:Lrp5	APN	19	3593585	missense	probably damaging	1.00
IGL02471:Lrp5	APN	19	3602408	missense	probably benign	0.31
IGL02572:Lrp5	APN	19	3614283	missense	probably benign	0.17
IGL02637:Lrp5	APN	19	3630269	missense	probably benign	0.03
IGL02696:Lrp5	APN	19	3602253	missense	probably benign
IGL02742:Lrp5	APN	19	3604022	missense	probably damaging	0.99
IGL02804:Lrp5	APN	19	3600777	missense	possibly damaging	0.63
IGL03089:Lrp5	APN	19	3620314	splice site	probably null
IGL03243:Lrp5	APN	19	3630159	missense	probably benign	0.12
Contrarian	UTSW	19	3659355	missense	probably damaging	1.00
Contrarian2	UTSW	19	3652296	missense	probably damaging	1.00
lucent	UTSW	19	3686353	critical splice donor site	probably null
Microtome	UTSW	19	3622638	missense	probably damaging	1.00
r18	UTSW	19		small insertion
Spicule	UTSW	19	3612197	critical splice donor site	probably null
stirrup	UTSW	19	3600753	missense	probably damaging	1.00
PIT4494001:Lrp5	UTSW	19	3610091	missense	probably damaging	1.00
R0219:Lrp5	UTSW	19	3597349	missense	probably damaging	1.00
R0526:Lrp5	UTSW	19	3628295	missense	probably damaging	1.00
R0597:Lrp5	UTSW	19	3600777	missense	possibly damaging	0.63
R0883:Lrp5	UTSW	19	3605308	missense	probably damaging	1.00
R1086:Lrp5	UTSW	19	3649476	missense	probably benign	0.28
R1417:Lrp5	UTSW	19	3586425	missense	probably benign	0.04
R1468:Lrp5	UTSW	19	3620191	missense	possibly damaging	0.76
R1468:Lrp5	UTSW	19	3620191	missense	possibly damaging	0.76
R1533:Lrp5	UTSW	19	3614234	missense	probably benign	0.17
R1538:Lrp5	UTSW	19	3647585	missense	possibly damaging	0.70
R1856:Lrp5	UTSW	19	3597346	missense	probably benign	0.18
R1930:Lrp5	UTSW	19	3610131	missense	probably benign	0.02
R1931:Lrp5	UTSW	19	3610131	missense	probably benign	0.02
R1932:Lrp5	UTSW	19	3610131	missense	probably benign	0.02
R1951:Lrp5	UTSW	19	3620298	missense	possibly damaging	0.89
R2016:Lrp5	UTSW	19	3610056	missense	probably benign	0.04
R2131:Lrp5	UTSW	19	3622708	missense	possibly damaging	0.87
R2153:Lrp5	UTSW	19	3614339	missense	probably benign	0.22
R2403:Lrp5	UTSW	19	3597430	missense	probably damaging	1.00
R3158:Lrp5	UTSW	19	3615849	missense	probably damaging	0.97
R3771:Lrp5	UTSW	19	3612330	missense	probably damaging	1.00
R3772:Lrp5	UTSW	19	3612330	missense	probably damaging	1.00
R3773:Lrp5	UTSW	19	3612330	missense	probably damaging	1.00
R3825:Lrp5	UTSW	19	3605290	nonsense	probably null
R3887:Lrp5	UTSW	19	3612330	missense	probably damaging	1.00
R3888:Lrp5	UTSW	19	3612330	missense	probably damaging	1.00
R3893:Lrp5	UTSW	19	3612330	missense	probably damaging	1.00
R3917:Lrp5	UTSW	19	3612330	missense	probably damaging	1.00
R4279:Lrp5	UTSW	19	3591778	missense	possibly damaging	0.94
R4714:Lrp5	UTSW	19	3659454	missense	probably damaging	1.00
R4825:Lrp5	UTSW	19	3614292	missense	probably damaging	1.00
R5102:Lrp5	UTSW	19	3659304	missense	probably damaging	0.96
R5138:Lrp5	UTSW	19	3628319	missense	probably benign	0.03
R5497:Lrp5	UTSW	19	3602319	missense	probably damaging	1.00
R5632:Lrp5	UTSW	19	3622512	missense	probably benign
R5887:Lrp5	UTSW	19	3604094	missense	probably benign	0.01
R5950:Lrp5	UTSW	19	3602333	missense	probably benign	0.17
R5987:Lrp5	UTSW	19	3628299	missense	probably damaging	1.00
R6080:Lrp5	UTSW	19	3628316	missense	probably benign	0.32
R6181:Lrp5	UTSW	19	3628427	missense	probably damaging	1.00
R6236:Lrp5	UTSW	19	3630483	splice site	probably null
R6332:Lrp5	UTSW	19	3659355	missense	probably damaging	1.00
R6511:Lrp5	UTSW	19	3652296	missense	probably damaging	1.00
R6641:Lrp5	UTSW	19	3652287	missense	probably damaging	1.00
R6791:Lrp5	UTSW	19	3600753	missense	probably damaging	1.00
R6865:Lrp5	UTSW	19	3620013	critical splice donor site	probably null
R6906:Lrp5	UTSW	19	3622638	missense	probably damaging	1.00
R6922:Lrp5	UTSW	19	3605301	missense	probably damaging	1.00
R7091:Lrp5	UTSW	19	3630184	missense	probably damaging	1.00
R7303:Lrp5	UTSW	19	3591774	missense	probably damaging	0.99
R7381:Lrp5	UTSW	19	3593588	missense	probably benign	0.20
R7385:Lrp5	UTSW	19	3612197	critical splice donor site	probably null
R7392:Lrp5	UTSW	19	3610199	missense	probably damaging	1.00
R7448:Lrp5	UTSW	19	3649439	missense	probably benign	0.01
R7585:Lrp5	UTSW	19	3604094	missense	possibly damaging	0.88
R7662:Lrp5	UTSW	19	3686353	critical splice donor site	probably null
R7984:Lrp5	UTSW	19	3612342	missense	probably damaging	1.00
R8056:Lrp5	UTSW	19	3597337	missense	probably damaging	0.98
R8391:Lrp5	UTSW	19	3604185	missense	probably damaging	1.00
Z1177:Lrp5	UTSW	19	3628345	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GCCATCTCTCTAGCCCTAATACAATAG -3'
(R):5'- AAATGGAGGGTGCAGCCATC -3'

Sequencing Primer
(F):5'- TCTAGCCCTAATACAATAGACAGTTC -3'
(R):5'- GGTGCAGCCATCTGTGCTTC -3'

Posted On

2019-09-13