Incidental Mutation 'R0453:Myocd'
ID39794
Institutional Source Beutler Lab
Gene Symbol Myocd
Ensembl Gene ENSMUSG00000020542
Gene Namemyocardin
SynonymsSrfcp
MMRRC Submission 038653-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0453 (G1)
Quality Score197
Status Validated
Chromosome11
Chromosomal Location65176561-65269989 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65196225 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 292 (F292S)
Ref Sequence ENSEMBL: ENSMUSP00000104335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101042] [ENSMUST00000102635] [ENSMUST00000108695]
Predicted Effect probably damaging
Transcript: ENSMUST00000101042
AA Change: F164S

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098603
Gene: ENSMUSG00000020542
AA Change: F164S

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
SCOP:d1lsha3 140 221 4e-3 SMART
SAP 252 286 1.29e-8 SMART
low complexity region 326 343 N/A INTRINSIC
low complexity region 371 383 N/A INTRINSIC
coiled coil region 396 435 N/A INTRINSIC
low complexity region 557 573 N/A INTRINSIC
low complexity region 615 629 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102635
AA Change: F292S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099695
Gene: ENSMUSG00000020542
AA Change: F292S

DomainStartEndE-ValueType
RPEL 18 43 4e-1 SMART
RPEL 62 87 9.26e0 SMART
RPEL 106 131 1.15e-6 SMART
low complexity region 147 160 N/A INTRINSIC
low complexity region 247 260 N/A INTRINSIC
SCOP:d1lsha3 268 349 4e-3 SMART
SAP 380 414 1.29e-8 SMART
low complexity region 454 471 N/A INTRINSIC
low complexity region 499 511 N/A INTRINSIC
coiled coil region 524 563 N/A INTRINSIC
low complexity region 695 709 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108695
AA Change: F292S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104335
Gene: ENSMUSG00000020542
AA Change: F292S

DomainStartEndE-ValueType
RPEL 18 43 4e-1 SMART
RPEL 62 87 9.26e0 SMART
RPEL 106 131 1.15e-6 SMART
low complexity region 147 160 N/A INTRINSIC
low complexity region 247 260 N/A INTRINSIC
SCOP:d1lsha3 268 349 5e-3 SMART
SAP 380 414 1.29e-8 SMART
low complexity region 454 471 N/A INTRINSIC
low complexity region 499 511 N/A INTRINSIC
coiled coil region 524 563 N/A INTRINSIC
low complexity region 685 701 N/A INTRINSIC
low complexity region 743 757 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000144399
AA Change: F166S
SMART Domains Protein: ENSMUSP00000115572
Gene: ENSMUSG00000020542
AA Change: F166S

DomainStartEndE-ValueType
low complexity region 22 35 N/A INTRINSIC
low complexity region 122 135 N/A INTRINSIC
low complexity region 160 195 N/A INTRINSIC
Meta Mutation Damage Score 0.8656 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.6%
Validation Efficiency 99% (97/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein, which is expressed in heart, aorta, and in smooth muscle cell-containing tissues. It functions as a transcriptional co-activator of serum response factor (SRF) and modulates expression of cardiac and smooth muscle-specific SRF-target genes, and thus may play a crucial role in cardiogenesis and differentiation of the smooth muscle cell lineage. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null mutation exhibit embryonic lethality and fail to form vascular smooth muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,753,668 Y715C probably damaging Het
Acad10 T A 5: 121,627,382 K843* probably null Het
Adam26b T C 8: 43,520,350 I538M probably benign Het
Adamtsl1 T C 4: 86,232,615 Y337H probably damaging Het
Ak7 T C 12: 105,716,048 M156T probably damaging Het
Aldh3a1 A G 11: 61,215,512 M238V probably benign Het
Asic4 T A 1: 75,473,511 probably benign Het
AW551984 A G 9: 39,600,641 S25P probably damaging Het
Bbs7 T A 3: 36,607,669 Y127F possibly damaging Het
BC049730 T A 7: 24,714,287 S243T probably benign Het
Bco1 G A 8: 117,108,777 E156K possibly damaging Het
Becn1 T C 11: 101,290,449 D342G probably damaging Het
Birc6 T A 17: 74,649,754 I3575N probably damaging Het
Cc2d2a A T 5: 43,703,294 M522L probably benign Het
Cerkl A G 2: 79,342,451 F293L probably benign Het
Chil3 T G 3: 106,148,905 N311T probably benign Het
Cpeb2 T A 5: 43,285,713 probably benign Het
Cpxm2 A G 7: 132,128,405 S162P probably damaging Het
Cracr2b A C 7: 141,464,263 E136A probably damaging Het
Cyp2a4 T A 7: 26,312,833 M347K probably benign Het
Dicer1 C A 12: 104,702,630 R1264S probably benign Het
Dlgap1 T A 17: 70,761,346 N609K probably benign Het
Dnhd1 A G 7: 105,674,444 T641A probably benign Het
Egfl8 T C 17: 34,614,882 Y74C probably damaging Het
Esyt1 A G 10: 128,512,209 S901P probably benign Het
Fam83e A T 7: 45,723,948 D246V probably damaging Het
Galnt2 T C 8: 124,338,584 probably benign Het
Hdc A G 2: 126,594,951 probably benign Het
Herc1 A C 9: 66,399,772 Q958P probably benign Het
Iqcg T A 16: 33,049,843 probably benign Het
Iqub A T 6: 24,450,830 F590Y probably damaging Het
Jak2 T C 19: 29,311,838 I1130T probably benign Het
Kbtbd11 G A 8: 15,027,499 A33T probably benign Het
Kcnip4 A G 5: 48,509,712 L37P probably damaging Het
Klk6 A G 7: 43,828,539 N112D probably damaging Het
Kmt2c G A 5: 25,354,747 T1011I probably damaging Het
Knl1 A T 2: 119,068,388 K190M probably damaging Het
Lama3 T A 18: 12,465,478 S981T possibly damaging Het
Lrrc18 T C 14: 33,008,651 L49P probably damaging Het
Lrrc31 T C 3: 30,687,525 E245G probably damaging Het
Macf1 T C 4: 123,444,944 I2456M probably benign Het
Mcm6 T A 1: 128,333,555 T771S probably benign Het
Met A C 6: 17,534,198 Y680S possibly damaging Het
Mixl1 T A 1: 180,696,646 T123S probably damaging Het
Myh8 A T 11: 67,292,905 I787F probably benign Het
Neb T C 2: 52,313,890 probably null Het
Nfe2l1 A G 11: 96,827,368 S114P probably damaging Het
Nrxn2 T C 19: 6,491,521 S986P probably damaging Het
Olfr1246 A T 2: 89,590,751 Y121* probably null Het
Olfr1453 T G 19: 13,027,931 T133P probably damaging Het
Olfr25 A T 9: 38,330,171 T195S probably benign Het
Olfr745 T C 14: 50,643,004 V241A possibly damaging Het
Olfr767 A G 10: 129,079,771 F64S probably damaging Het
Olfr920 G A 9: 38,756,129 G147D probably damaging Het
Oprl1 T C 2: 181,718,734 probably null Het
Panx2 T A 15: 89,068,407 I359N probably damaging Het
Pik3c2b T A 1: 133,077,396 V545E probably damaging Het
Piwil4 T C 9: 14,727,452 N259S probably benign Het
Plcxd2 A T 16: 45,980,556 F102I probably damaging Het
Pld5 A T 1: 176,089,956 M75K possibly damaging Het
Pmp22 T A 11: 63,151,103 probably benign Het
Polr2a A G 11: 69,741,019 S1074P possibly damaging Het
Pop1 T A 15: 34,526,206 V649E possibly damaging Het
Prc1 A G 7: 80,313,102 N548S probably damaging Het
Prss51 T C 14: 64,097,139 L202P probably damaging Het
Rhpn1 T C 15: 75,713,579 S576P possibly damaging Het
Rictor A G 15: 6,708,642 D20G probably benign Het
Rpl13a-ps1 A T 19: 50,030,206 L177* probably null Het
Rpl23a-ps1 T G 1: 45,981,927 noncoding transcript Het
Saa2 A G 7: 46,753,478 D51G probably damaging Het
Sec31a A T 5: 100,404,118 probably benign Het
Secisbp2 G A 13: 51,683,325 E841K possibly damaging Het
Serinc1 A G 10: 57,517,210 Y437H probably damaging Het
Slc39a12 A T 2: 14,435,681 H481L probably benign Het
Suz12 T A 11: 80,030,033 N586K probably damaging Het
Synm T C 7: 67,736,882 Y344C possibly damaging Het
Tas2r104 A G 6: 131,685,341 V135A probably benign Het
Tdrd9 T C 12: 112,068,239 S1371P probably benign Het
Tg T A 15: 66,828,533 D893E probably benign Het
Thoc5 C A 11: 4,918,217 D423E possibly damaging Het
Trim11 G A 11: 58,990,535 R418H probably damaging Het
Trim52 T G 14: 106,106,965 V19G probably damaging Het
Tuba4a C A 1: 75,215,858 V371L probably damaging Het
Ugt8a A G 3: 125,914,957 V168A probably benign Het
Ulk1 C T 5: 110,791,085 G496R probably damaging Het
Usp40 A G 1: 87,946,598 *1236Q probably null Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r24 A G 6: 123,780,391 probably null Het
Vmn2r53 A G 7: 12,582,411 Y494H probably damaging Het
Vmn2r65 T A 7: 84,946,234 D414V probably benign Het
Wdr26 A T 1: 181,182,879 L519* probably null Het
Wnk1 A G 6: 119,963,151 V173A probably damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp318 T C 17: 46,396,708 S231P probably damaging Het
Zfp398 T C 6: 47,865,848 V146A probably benign Het
Zfp410 T C 12: 84,331,712 M270T probably damaging Het
Zfp445 A T 9: 122,853,513 H454Q possibly damaging Het
Other mutations in Myocd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Myocd APN 11 65180944 critical splice acceptor site probably null
IGL00481:Myocd APN 11 65187154 missense probably damaging 0.99
IGL00857:Myocd APN 11 65178836 missense possibly damaging 0.93
IGL01012:Myocd APN 11 65184625 missense possibly damaging 0.51
IGL01570:Myocd APN 11 65200807 missense probably benign 0.00
IGL01865:Myocd APN 11 65200897 missense probably benign 0.30
IGL01938:Myocd APN 11 65187088 missense probably damaging 1.00
IGL02324:Myocd APN 11 65178658 missense probably benign 0.01
IGL02598:Myocd APN 11 65183470 missense probably benign 0.31
IGL02886:Myocd APN 11 65178743 missense probably damaging 0.99
IGL03008:Myocd APN 11 65187566 missense probably damaging 0.98
IGL03034:Myocd APN 11 65218685 missense probably benign 0.00
harvey UTSW 11 65179030 splice site probably null
irma UTSW 11 65196394 missense probably damaging 0.97
Nate UTSW 11 65233088 intron probably null
R0078:Myocd UTSW 11 65187464 missense possibly damaging 0.96
R0097:Myocd UTSW 11 65179014 missense possibly damaging 0.67
R0097:Myocd UTSW 11 65179014 missense possibly damaging 0.67
R0234:Myocd UTSW 11 65187240 missense probably benign 0.01
R0234:Myocd UTSW 11 65187240 missense probably benign 0.01
R0523:Myocd UTSW 11 65180902 missense probably damaging 1.00
R0838:Myocd UTSW 11 65178932 missense probably benign 0.00
R0899:Myocd UTSW 11 65195192 missense possibly damaging 0.50
R1167:Myocd UTSW 11 65196377 missense possibly damaging 0.77
R1472:Myocd UTSW 11 65187504 missense probably benign 0.01
R1508:Myocd UTSW 11 65184516 missense probably damaging 0.98
R1620:Myocd UTSW 11 65196394 missense probably damaging 0.97
R1630:Myocd UTSW 11 65196394 missense probably damaging 0.97
R1731:Myocd UTSW 11 65200888 missense probably benign 0.30
R1740:Myocd UTSW 11 65218521 splice site probably benign
R1769:Myocd UTSW 11 65178701 missense probably benign 0.01
R1823:Myocd UTSW 11 65178670 missense probably benign 0.00
R1968:Myocd UTSW 11 65200907 missense probably damaging 1.00
R1997:Myocd UTSW 11 65204321 nonsense probably null
R2018:Myocd UTSW 11 65187028 missense probably damaging 1.00
R2105:Myocd UTSW 11 65218658 nonsense probably null
R2314:Myocd UTSW 11 65200807 missense probably damaging 1.00
R4330:Myocd UTSW 11 65223764 missense probably benign 0.12
R4331:Myocd UTSW 11 65223764 missense probably benign 0.12
R4603:Myocd UTSW 11 65187745 missense possibly damaging 0.82
R4619:Myocd UTSW 11 65178428 utr 3 prime probably benign
R4631:Myocd UTSW 11 65178859 missense probably benign 0.10
R4865:Myocd UTSW 11 65179030 splice site probably null
R4974:Myocd UTSW 11 65183473 missense possibly damaging 0.78
R4976:Myocd UTSW 11 65222050 missense probably benign 0.00
R5478:Myocd UTSW 11 65233088 intron probably null
R5499:Myocd UTSW 11 65178749 missense possibly damaging 0.62
R6052:Myocd UTSW 11 65196256 missense probably damaging 1.00
R6356:Myocd UTSW 11 65218570 unclassified probably null
R7144:Myocd UTSW 11 65218648 missense probably damaging 1.00
R7261:Myocd UTSW 11 65187596 missense probably damaging 0.98
R7354:Myocd UTSW 11 65187493 missense probably benign 0.00
R7461:Myocd UTSW 11 65218603 missense probably damaging 1.00
R7613:Myocd UTSW 11 65218603 missense probably damaging 1.00
R7718:Myocd UTSW 11 65218626 missense probably damaging 1.00
X0057:Myocd UTSW 11 65183445 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GGGAGTCAGAGGCCAAACATATCAC -3'
(R):5'- TCCAAGAGCCCAGTAAGGTGTAAGG -3'

Sequencing Primer
(F):5'- ATGATGTAATACAGGACACACTGGTC -3'
(R):5'- ATACATGAGTGCTGTGCCTTAC -3'
Posted On2013-05-23