Incidental Mutation 'R0453:Knl1'
ID39742
Institutional Source Beutler Lab
Gene Symbol Knl1
Ensembl Gene ENSMUSG00000027326
Gene Namekinetochore scaffold 1
Synonyms2310043D08Rik, 5730505K17Rik
MMRRC Submission 038653-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0453 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location119047119-119105501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119068388 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 190 (K190M)
Ref Sequence ENSEMBL: ENSMUSP00000118646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028799] [ENSMUST00000028802] [ENSMUST00000099542] [ENSMUST00000152380] [ENSMUST00000153300]
Predicted Effect probably damaging
Transcript: ENSMUST00000028799
AA Change: K190M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028799
Gene: ENSMUSG00000027326
AA Change: K190M

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
PDB:4A1G|H 126 175 1e-13 PDB
low complexity region 426 433 N/A INTRINSIC
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000028802
AA Change: K190M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028802
Gene: ENSMUSG00000027326
AA Change: K190M

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
internal_repeat_1 98 304 1.57e-6 PROSPERO
low complexity region 426 433 N/A INTRINSIC
internal_repeat_1 610 824 1.57e-6 PROSPERO
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
low complexity region 1621 1644 N/A INTRINSIC
coiled coil region 1724 1755 N/A INTRINSIC
low complexity region 1836 1850 N/A INTRINSIC
low complexity region 1864 1878 N/A INTRINSIC
PDB:4NF9|B 1899 2119 1e-115 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000099542
AA Change: K190M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097140
Gene: ENSMUSG00000027326
AA Change: K190M

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
internal_repeat_1 98 304 1.57e-6 PROSPERO
low complexity region 426 433 N/A INTRINSIC
internal_repeat_1 610 824 1.57e-6 PROSPERO
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
low complexity region 1621 1644 N/A INTRINSIC
coiled coil region 1724 1755 N/A INTRINSIC
low complexity region 1836 1850 N/A INTRINSIC
low complexity region 1864 1878 N/A INTRINSIC
PDB:4NF9|B 1899 2119 1e-115 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000152380
AA Change: K190M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118646
Gene: ENSMUSG00000027326
AA Change: K190M

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
PDB:4A1G|H 126 175 3e-14 PDB
low complexity region 426 433 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153300
SMART Domains Protein: ENSMUSP00000120905
Gene: ENSMUSG00000027326

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.6%
Validation Efficiency 99% (97/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the multiprotein assembly that is required for creation of kinetochore-microtubule attachments and chromosome segregation. The encoded protein functions as a scaffold for proteins that influence the spindle assembly checkpoint during the eukaryotic cell cycle and it interacts with at least five different kinetochore proteins and two checkpoint kinases. In adults, this gene is predominantly expressed in normal testes, various cancer cell lines and primary tumors from other tissues and is ubiquitously expressed in fetal tissues. This gene was originally identified as a fusion partner with the mixed-lineage leukemia (MLL) gene in t(11;15)(q23;q14). Mutations in this gene cause autosomal recessive primary microcephaly-4 (MCPH4). Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. Mice homozygous for an ENU-induced allele exhibit possible embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,753,668 Y715C probably damaging Het
Acad10 T A 5: 121,627,382 K843* probably null Het
Adam26b T C 8: 43,520,350 I538M probably benign Het
Adamtsl1 T C 4: 86,232,615 Y337H probably damaging Het
Ak7 T C 12: 105,716,048 M156T probably damaging Het
Aldh3a1 A G 11: 61,215,512 M238V probably benign Het
Asic4 T A 1: 75,473,511 probably benign Het
AW551984 A G 9: 39,600,641 S25P probably damaging Het
Bbs7 T A 3: 36,607,669 Y127F possibly damaging Het
BC049730 T A 7: 24,714,287 S243T probably benign Het
Bco1 G A 8: 117,108,777 E156K possibly damaging Het
Becn1 T C 11: 101,290,449 D342G probably damaging Het
Birc6 T A 17: 74,649,754 I3575N probably damaging Het
Cc2d2a A T 5: 43,703,294 M522L probably benign Het
Cerkl A G 2: 79,342,451 F293L probably benign Het
Chil3 T G 3: 106,148,905 N311T probably benign Het
Cpeb2 T A 5: 43,285,713 probably benign Het
Cpxm2 A G 7: 132,128,405 S162P probably damaging Het
Cracr2b A C 7: 141,464,263 E136A probably damaging Het
Cyp2a4 T A 7: 26,312,833 M347K probably benign Het
Dicer1 C A 12: 104,702,630 R1264S probably benign Het
Dlgap1 T A 17: 70,761,346 N609K probably benign Het
Dnhd1 A G 7: 105,674,444 T641A probably benign Het
Egfl8 T C 17: 34,614,882 Y74C probably damaging Het
Esyt1 A G 10: 128,512,209 S901P probably benign Het
Fam83e A T 7: 45,723,948 D246V probably damaging Het
Galnt2 T C 8: 124,338,584 probably benign Het
Hdc A G 2: 126,594,951 probably benign Het
Herc1 A C 9: 66,399,772 Q958P probably benign Het
Iqcg T A 16: 33,049,843 probably benign Het
Iqub A T 6: 24,450,830 F590Y probably damaging Het
Jak2 T C 19: 29,311,838 I1130T probably benign Het
Kbtbd11 G A 8: 15,027,499 A33T probably benign Het
Kcnip4 A G 5: 48,509,712 L37P probably damaging Het
Klk6 A G 7: 43,828,539 N112D probably damaging Het
Kmt2c G A 5: 25,354,747 T1011I probably damaging Het
Lama3 T A 18: 12,465,478 S981T possibly damaging Het
Lrrc18 T C 14: 33,008,651 L49P probably damaging Het
Lrrc31 T C 3: 30,687,525 E245G probably damaging Het
Macf1 T C 4: 123,444,944 I2456M probably benign Het
Mcm6 T A 1: 128,333,555 T771S probably benign Het
Met A C 6: 17,534,198 Y680S possibly damaging Het
Mixl1 T A 1: 180,696,646 T123S probably damaging Het
Myh8 A T 11: 67,292,905 I787F probably benign Het
Myocd A G 11: 65,196,225 F292S probably damaging Het
Neb T C 2: 52,313,890 probably null Het
Nfe2l1 A G 11: 96,827,368 S114P probably damaging Het
Nrxn2 T C 19: 6,491,521 S986P probably damaging Het
Olfr1246 A T 2: 89,590,751 Y121* probably null Het
Olfr1453 T G 19: 13,027,931 T133P probably damaging Het
Olfr25 A T 9: 38,330,171 T195S probably benign Het
Olfr745 T C 14: 50,643,004 V241A possibly damaging Het
Olfr767 A G 10: 129,079,771 F64S probably damaging Het
Olfr920 G A 9: 38,756,129 G147D probably damaging Het
Oprl1 T C 2: 181,718,734 probably null Het
Panx2 T A 15: 89,068,407 I359N probably damaging Het
Pik3c2b T A 1: 133,077,396 V545E probably damaging Het
Piwil4 T C 9: 14,727,452 N259S probably benign Het
Plcxd2 A T 16: 45,980,556 F102I probably damaging Het
Pld5 A T 1: 176,089,956 M75K possibly damaging Het
Pmp22 T A 11: 63,151,103 probably benign Het
Polr2a A G 11: 69,741,019 S1074P possibly damaging Het
Pop1 T A 15: 34,526,206 V649E possibly damaging Het
Prc1 A G 7: 80,313,102 N548S probably damaging Het
Prss51 T C 14: 64,097,139 L202P probably damaging Het
Rhpn1 T C 15: 75,713,579 S576P possibly damaging Het
Rictor A G 15: 6,708,642 D20G probably benign Het
Rpl13a-ps1 A T 19: 50,030,206 L177* probably null Het
Rpl23a-ps1 T G 1: 45,981,927 noncoding transcript Het
Saa2 A G 7: 46,753,478 D51G probably damaging Het
Sec31a A T 5: 100,404,118 probably benign Het
Secisbp2 G A 13: 51,683,325 E841K possibly damaging Het
Serinc1 A G 10: 57,517,210 Y437H probably damaging Het
Slc39a12 A T 2: 14,435,681 H481L probably benign Het
Suz12 T A 11: 80,030,033 N586K probably damaging Het
Synm T C 7: 67,736,882 Y344C possibly damaging Het
Tas2r104 A G 6: 131,685,341 V135A probably benign Het
Tdrd9 T C 12: 112,068,239 S1371P probably benign Het
Tg T A 15: 66,828,533 D893E probably benign Het
Thoc5 C A 11: 4,918,217 D423E possibly damaging Het
Trim11 G A 11: 58,990,535 R418H probably damaging Het
Trim52 T G 14: 106,106,965 V19G probably damaging Het
Tuba4a C A 1: 75,215,858 V371L probably damaging Het
Ugt8a A G 3: 125,914,957 V168A probably benign Het
Ulk1 C T 5: 110,791,085 G496R probably damaging Het
Usp40 A G 1: 87,946,598 *1236Q probably null Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r24 A G 6: 123,780,391 probably null Het
Vmn2r53 A G 7: 12,582,411 Y494H probably damaging Het
Vmn2r65 T A 7: 84,946,234 D414V probably benign Het
Wdr26 A T 1: 181,182,879 L519* probably null Het
Wnk1 A G 6: 119,963,151 V173A probably damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp318 T C 17: 46,396,708 S231P probably damaging Het
Zfp398 T C 6: 47,865,848 V146A probably benign Het
Zfp410 T C 12: 84,331,712 M270T probably damaging Het
Zfp445 A T 9: 122,853,513 H454Q possibly damaging Het
Other mutations in Knl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Knl1 APN 2 119064083 missense probably damaging 0.96
IGL00582:Knl1 APN 2 119102499 missense probably benign 0.19
IGL00666:Knl1 APN 2 119070464 missense probably damaging 0.96
IGL01062:Knl1 APN 2 119076980 missense probably benign 0.33
IGL01395:Knl1 APN 2 119071566 missense probably damaging 0.96
IGL01604:Knl1 APN 2 119070001 missense probably damaging 1.00
IGL01996:Knl1 APN 2 119104061 missense probably damaging 1.00
IGL02086:Knl1 APN 2 119100774 missense probably benign 0.40
IGL02105:Knl1 APN 2 119071808 missense probably benign
IGL02106:Knl1 APN 2 119072008 missense possibly damaging 0.89
IGL02201:Knl1 APN 2 119069152 missense probably benign 0.01
IGL02252:Knl1 APN 2 119072540 missense probably damaging 1.00
IGL02414:Knl1 APN 2 119070323 missense possibly damaging 0.83
IGL02655:Knl1 APN 2 119070992 missense possibly damaging 0.62
IGL02682:Knl1 APN 2 119077969 missense possibly damaging 0.86
IGL02710:Knl1 APN 2 119070930 missense probably damaging 0.99
IGL02877:Knl1 APN 2 119088831 missense probably benign 0.08
IGL03100:Knl1 APN 2 119100770 missense probably damaging 0.99
IGL03210:Knl1 APN 2 119070617 missense probably benign 0.02
IGL03138:Knl1 UTSW 2 119072359 missense probably damaging 0.96
R0023:Knl1 UTSW 2 119102549 missense possibly damaging 0.73
R0064:Knl1 UTSW 2 119076243 missense probably benign 0.00
R0064:Knl1 UTSW 2 119076243 missense probably benign 0.00
R0078:Knl1 UTSW 2 119069892 missense probably benign 0.16
R0178:Knl1 UTSW 2 119058405 splice site probably benign
R0295:Knl1 UTSW 2 119088839 missense probably damaging 1.00
R0433:Knl1 UTSW 2 119104061 missense probably damaging 0.96
R0569:Knl1 UTSW 2 119097435 missense possibly damaging 0.95
R0827:Knl1 UTSW 2 119088901 splice site probably benign
R0920:Knl1 UTSW 2 119069828 missense probably benign 0.00
R1120:Knl1 UTSW 2 119062375 missense probably damaging 0.99
R1155:Knl1 UTSW 2 119071154 missense possibly damaging 0.90
R1204:Knl1 UTSW 2 119071189 missense probably benign 0.00
R1241:Knl1 UTSW 2 119072573 missense probably benign 0.03
R1387:Knl1 UTSW 2 119070730 missense possibly damaging 0.93
R1448:Knl1 UTSW 2 119068307 missense probably damaging 1.00
R1469:Knl1 UTSW 2 119071346 missense possibly damaging 0.73
R1469:Knl1 UTSW 2 119071346 missense possibly damaging 0.73
R1719:Knl1 UTSW 2 119071738 missense probably benign 0.01
R1721:Knl1 UTSW 2 119076334 missense probably damaging 1.00
R2128:Knl1 UTSW 2 119071819 missense possibly damaging 0.79
R2170:Knl1 UTSW 2 119087594 critical splice donor site probably null
R2227:Knl1 UTSW 2 119072000 missense probably damaging 0.97
R2246:Knl1 UTSW 2 119072227 missense probably damaging 1.00
R2275:Knl1 UTSW 2 119072281 missense probably damaging 0.99
R2508:Knl1 UTSW 2 119058368 nonsense probably null
R3115:Knl1 UTSW 2 119070391 missense possibly damaging 0.53
R3122:Knl1 UTSW 2 119068944 missense probably benign 0.32
R3431:Knl1 UTSW 2 119062362 missense probably damaging 1.00
R3755:Knl1 UTSW 2 119102579 missense probably damaging 1.00
R4461:Knl1 UTSW 2 119059599 missense probably benign 0.00
R4600:Knl1 UTSW 2 119070544 missense possibly damaging 0.90
R4713:Knl1 UTSW 2 119069137 nonsense probably null
R4758:Knl1 UTSW 2 119071732 frame shift probably null
R4762:Knl1 UTSW 2 119071936 missense probably benign 0.01
R4869:Knl1 UTSW 2 119072351 missense possibly damaging 0.73
R4870:Knl1 UTSW 2 119081513 missense probably benign 0.22
R4935:Knl1 UTSW 2 119068957 missense possibly damaging 0.50
R5167:Knl1 UTSW 2 119070031 missense probably damaging 1.00
R5184:Knl1 UTSW 2 119069176 missense probably damaging 1.00
R5293:Knl1 UTSW 2 119069695 missense probably damaging 0.99
R5326:Knl1 UTSW 2 119068348 missense possibly damaging 0.66
R5331:Knl1 UTSW 2 119070255 missense possibly damaging 0.92
R5353:Knl1 UTSW 2 119070983 missense probably benign 0.01
R5493:Knl1 UTSW 2 119068730 missense probably damaging 0.98
R5542:Knl1 UTSW 2 119068348 missense possibly damaging 0.66
R5632:Knl1 UTSW 2 119070352 missense probably damaging 1.00
R5650:Knl1 UTSW 2 119081550 nonsense probably null
R5854:Knl1 UTSW 2 119070403 missense probably benign 0.02
R5979:Knl1 UTSW 2 119069360 missense possibly damaging 0.83
R6086:Knl1 UTSW 2 119094068 missense probably damaging 1.00
R6283:Knl1 UTSW 2 119070286 missense probably damaging 1.00
R6285:Knl1 UTSW 2 119071941 missense probably damaging 1.00
R6313:Knl1 UTSW 2 119069318 missense probably damaging 1.00
R6419:Knl1 UTSW 2 119069003 missense probably benign 0.02
R6608:Knl1 UTSW 2 119086612 missense probably damaging 0.99
R6881:Knl1 UTSW 2 119095184 missense possibly damaging 0.67
R7161:Knl1 UTSW 2 119070785 missense possibly damaging 0.79
R7206:Knl1 UTSW 2 119069299 missense probably benign 0.35
R7270:Knl1 UTSW 2 119102522 missense possibly damaging 0.53
R7276:Knl1 UTSW 2 119071686 missense probably damaging 0.98
R7358:Knl1 UTSW 2 119070559 missense possibly damaging 0.92
R7402:Knl1 UTSW 2 119095226 nonsense probably null
R7408:Knl1 UTSW 2 119070592 missense possibly damaging 0.54
R7475:Knl1 UTSW 2 119087546 missense probably damaging 1.00
R7516:Knl1 UTSW 2 119070698 missense probably damaging 0.99
R7524:Knl1 UTSW 2 119065979 missense probably damaging 1.00
R7559:Knl1 UTSW 2 119094006 missense possibly damaging 0.84
R7607:Knl1 UTSW 2 119095133 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ATGGATCTGACAGCAAGTCACACTG -3'
(R):5'- CCGTGGATGGAGGAATCCAAGTCTT -3'

Sequencing Primer
(F):5'- TGACAGCAAGTCACACTGTAATG -3'
(R):5'- GGAATCCAAGTCTTAATACAGGCTG -3'
Posted On2013-05-23