Incidental Mutation 'R5251:Fgfr3'
ID399027
Institutional Source Beutler Lab
Gene Symbol Fgfr3
Ensembl Gene ENSMUSG00000054252
Gene Namefibroblast growth factor receptor 3
Synonymssam3, Fgfr-3, HBGFR
MMRRC Submission 042822-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.407) question?
Stock #R5251 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location33721674-33737068 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 33735556 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000005431] [ENSMUST00000067150] [ENSMUST00000087820] [ENSMUST00000114411] [ENSMUST00000164207] [ENSMUST00000169212] [ENSMUST00000171509] [ENSMUST00000201295] [ENSMUST00000202138]
Predicted Effect probably benign
Transcript: ENSMUST00000005431
SMART Domains Protein: ENSMUSP00000005431
Gene: ENSMUSG00000005299

DomainStartEndE-ValueType
low complexity region 10 30 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
Pfam:LETM1 152 417 1.2e-111 PFAM
coiled coil region 445 493 N/A INTRINSIC
low complexity region 503 513 N/A INTRINSIC
coiled coil region 537 598 N/A INTRINSIC
SCOP:d1c7va_ 647 691 4e-3 SMART
coiled coil region 708 738 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000067150
AA Change: T800M
SMART Domains Protein: ENSMUSP00000070998
Gene: ENSMUSG00000054252
AA Change: T800M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 50 114 5.01e-4 SMART
low complexity region 125 144 N/A INTRINSIC
IGc2 161 229 1.2e-15 SMART
IGc2 260 340 3.28e-8 SMART
transmembrane domain 367 389 N/A INTRINSIC
TyrKc 466 742 3.14e-153 SMART
low complexity region 765 781 N/A INTRINSIC
low complexity region 789 798 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000087820
AA Change: T782M
SMART Domains Protein: ENSMUSP00000085122
Gene: ENSMUSG00000054252
AA Change: T782M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 50 114 5.01e-4 SMART
IGc2 143 211 1.2e-15 SMART
IGc2 242 322 3.28e-8 SMART
transmembrane domain 349 371 N/A INTRINSIC
TyrKc 448 724 3.14e-153 SMART
low complexity region 747 763 N/A INTRINSIC
low complexity region 771 780 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000114411
AA Change: T802M
SMART Domains Protein: ENSMUSP00000110053
Gene: ENSMUSG00000054252
AA Change: T802M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 50 114 5.01e-4 SMART
low complexity region 125 144 N/A INTRINSIC
IGc2 161 229 1.2e-15 SMART
IGc2 260 339 2.77e-6 SMART
transmembrane domain 369 391 N/A INTRINSIC
TyrKc 468 744 3.14e-153 SMART
low complexity region 767 783 N/A INTRINSIC
low complexity region 791 800 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132724
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142860
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152661
Predicted Effect unknown
Transcript: ENSMUST00000164207
AA Change: T801M
SMART Domains Protein: ENSMUSP00000133064
Gene: ENSMUSG00000054252
AA Change: T801M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 50 114 5.01e-4 SMART
low complexity region 125 144 N/A INTRINSIC
IGc2 161 229 1.2e-15 SMART
IGc2 260 340 3.28e-8 SMART
transmembrane domain 367 389 N/A INTRINSIC
TyrKc 467 743 3.14e-153 SMART
low complexity region 766 782 N/A INTRINSIC
low complexity region 790 799 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000169212
AA Change: T800M
SMART Domains Protein: ENSMUSP00000130856
Gene: ENSMUSG00000054252
AA Change: T800M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 50 114 5.01e-4 SMART
low complexity region 125 144 N/A INTRINSIC
IGc2 161 229 1.2e-15 SMART
IGc2 260 340 3.28e-8 SMART
transmembrane domain 367 389 N/A INTRINSIC
TyrKc 466 742 3.14e-153 SMART
low complexity region 765 781 N/A INTRINSIC
low complexity region 789 798 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000171509
AA Change: T802M
SMART Domains Protein: ENSMUSP00000131845
Gene: ENSMUSG00000054252
AA Change: T802M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 50 114 5.01e-4 SMART
low complexity region 125 144 N/A INTRINSIC
IGc2 161 229 1.2e-15 SMART
IGc2 260 339 2.77e-6 SMART
transmembrane domain 369 391 N/A INTRINSIC
TyrKc 468 744 3.14e-153 SMART
low complexity region 767 783 N/A INTRINSIC
low complexity region 791 800 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000181298
Predicted Effect probably benign
Transcript: ENSMUST00000201295
SMART Domains Protein: ENSMUSP00000144104
Gene: ENSMUSG00000054252

DomainStartEndE-ValueType
IG 11 71 1.9e-3 SMART
transmembrane domain 90 112 N/A INTRINSIC
PDB:2PSQ|B 126 223 2e-30 PDB
Blast:IG_like 140 223 2e-51 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000202138
AA Change: T782M
SMART Domains Protein: ENSMUSP00000143945
Gene: ENSMUSG00000054252
AA Change: T782M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 50 114 5.01e-4 SMART
IGc2 143 211 1.2e-15 SMART
IGc2 242 322 3.28e-8 SMART
transmembrane domain 349 371 N/A INTRINSIC
TyrKc 448 724 3.14e-153 SMART
low complexity region 747 763 N/A INTRINSIC
low complexity region 771 780 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202791
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the fibroblast growth factor receptor family. Members of this family are highly conserved proteins that differ from one another in their ligand affinities and tissue distribution. A representative protein consists of an extracellular region composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment, and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This family member binds acidic and basic fibroblast growth hormone and plays a role in bone development and maintenance. Mutations in this gene may be associated with craniosynostosis and multiple types of skeletal dysplasia. A pseudogene of this gene is located on chromosome 1. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Apr 2011]
PHENOTYPE: Mutant alleles generally cause skeletal deformities, with some causing decreased body size, premature death, or hearing loss due to developmental defects of the ear. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1 A T 5: 35,950,892 E194V probably damaging Het
Ankrd16 T A 2: 11,778,741 D51E probably damaging Het
Arhgef5 A G 6: 43,272,881 T189A possibly damaging Het
Camk4 A G 18: 33,184,879 D363G probably benign Het
Camta1 A G 4: 151,163,884 I199T probably damaging Het
Ccdc141 C T 2: 77,027,774 C1021Y probably damaging Het
Cdc34 C T 10: 79,685,256 S129L probably damaging Het
Cenph T A 13: 100,761,840 N185I possibly damaging Het
Colq A G 14: 31,539,819 probably null Het
Dph2 A T 4: 117,890,346 D280E probably damaging Het
Exosc5 A G 7: 25,667,755 Y224C probably damaging Het
Hs3st6 T A 17: 24,757,985 D146E probably benign Het
Igkv13-84 A T 6: 68,939,788 Q23L probably benign Het
Macf1 A G 4: 123,449,967 V2154A probably benign Het
Man1a2 T C 3: 100,620,099 E225G probably damaging Het
Mertk T C 2: 128,729,455 S110P probably damaging Het
Nav3 A G 10: 109,853,253 F388L probably damaging Het
Nme8 T C 13: 19,660,625 N98S probably benign Het
Nup205 A G 6: 35,196,482 probably null Het
Prl7d1 T C 13: 27,709,244 N228S probably benign Het
Prss23 T C 7: 89,510,322 K180E probably damaging Het
Psap G A 10: 60,301,700 D549N probably damaging Het
Sec16a A G 2: 26,439,345 V886A probably benign Het
Sh2d1b2 A T 1: 170,250,073 E81D probably benign Het
Tbx6 A T 7: 126,783,344 N254I probably damaging Het
Tchhl1 T C 3: 93,470,553 V188A possibly damaging Het
Trpc3 A T 3: 36,670,954 L291Q probably damaging Het
Zbtb38 G T 9: 96,687,108 T641N probably benign Het
Other mutations in Fgfr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Fgfr3 APN 5 33735140 missense possibly damaging 0.57
IGL01585:Fgfr3 APN 5 33733961 missense probably damaging 0.96
IGL03266:Fgfr3 APN 5 33734365 missense probably damaging 1.00
IGL03285:Fgfr3 APN 5 33735213 missense probably damaging 1.00
PIT4280001:Fgfr3 UTSW 5 33732232 missense probably benign 0.13
R0543:Fgfr3 UTSW 5 33729710 start codon destroyed probably null 0.00
R0604:Fgfr3 UTSW 5 33732782 missense probably damaging 0.99
R1496:Fgfr3 UTSW 5 33729750 missense probably damaging 0.96
R1861:Fgfr3 UTSW 5 33729746 missense probably damaging 1.00
R2919:Fgfr3 UTSW 5 33733940 missense probably damaging 1.00
R2920:Fgfr3 UTSW 5 33733940 missense probably damaging 1.00
R4361:Fgfr3 UTSW 5 33723332 intron probably benign
R4506:Fgfr3 UTSW 5 33729999 missense probably damaging 1.00
R4513:Fgfr3 UTSW 5 33723116 intron probably benign
R4647:Fgfr3 UTSW 5 33734986 unclassified probably benign
R5240:Fgfr3 UTSW 5 33730038 missense probably damaging 1.00
R5454:Fgfr3 UTSW 5 33723298 intron probably benign
R5595:Fgfr3 UTSW 5 33730003 missense probably damaging 1.00
R5984:Fgfr3 UTSW 5 33729705 missense probably damaging 1.00
R6753:Fgfr3 UTSW 5 33732159 missense probably benign 0.35
R6985:Fgfr3 UTSW 5 33735441 missense probably null 1.00
R7106:Fgfr3 UTSW 5 33731414 missense probably damaging 1.00
R7221:Fgfr3 UTSW 5 33732748 frame shift probably null
R7319:Fgfr3 UTSW 5 33727802 missense possibly damaging 0.88
R7373:Fgfr3 UTSW 5 33727690 missense probably benign 0.00
R7497:Fgfr3 UTSW 5 33735422 frame shift probably null
R7498:Fgfr3 UTSW 5 33735422 frame shift probably null
R7499:Fgfr3 UTSW 5 33735422 frame shift probably null
R7883:Fgfr3 UTSW 5 33733891 missense probably damaging 1.00
R7966:Fgfr3 UTSW 5 33733891 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATAGCCTGAACACAGATGGC -3'
(R):5'- AGCAGTGCATGTTCCCAAGG -3'

Sequencing Primer
(F):5'- TGCAAAGGGACAGTCCTGAC -3'
(R):5'- ATGTTCCCAAGGGGCCTCTG -3'
Posted On2016-07-06