Incidental Mutation 'R5252:Nexn'
ID399093
Institutional Source Beutler Lab
Gene Symbol Nexn
Ensembl Gene ENSMUSG00000039103
Gene Namenexilin
Synonyms1110046H09Rik, nF actin binding protein
MMRRC Submission 042823-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.586) question?
Stock #R5252 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location152236982-152266350 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 152237953 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 438 (T438A)
Ref Sequence ENSEMBL: ENSMUSP00000143133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046045] [ENSMUST00000106121] [ENSMUST00000166984] [ENSMUST00000198460] [ENSMUST00000199423] [ENSMUST00000199470] [ENSMUST00000199876] [ENSMUST00000200452]
Predicted Effect probably benign
Transcript: ENSMUST00000046045
AA Change: T508A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037120
Gene: ENSMUSG00000039103
AA Change: T508A

DomainStartEndE-ValueType
coiled coil region 40 92 N/A INTRINSIC
coiled coil region 176 358 N/A INTRINSIC
coiled coil region 391 419 N/A INTRINSIC
low complexity region 452 470 N/A INTRINSIC
low complexity region 487 493 N/A INTRINSIC
IG 519 603 4.82e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106121
SMART Domains Protein: ENSMUSP00000101727
Gene: ENSMUSG00000028034

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 3e-8 PDB
KH 94 164 1.09e-17 SMART
KH 179 251 2.33e-17 SMART
KH 269 339 1.32e-16 SMART
low complexity region 344 366 N/A INTRINSIC
KH 370 443 1.19e-14 SMART
low complexity region 513 527 N/A INTRINSIC
low complexity region 530 556 N/A INTRINSIC
Pfam:DUF1897 571 599 1.3e-7 PFAM
Pfam:DUF1897 600 624 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166984
SMART Domains Protein: ENSMUSP00000130145
Gene: ENSMUSG00000028034

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 3e-8 PDB
KH 94 164 1.09e-17 SMART
KH 179 251 2.33e-17 SMART
KH 269 339 1.32e-16 SMART
low complexity region 344 366 N/A INTRINSIC
KH 370 443 1.19e-14 SMART
low complexity region 513 527 N/A INTRINSIC
low complexity region 530 556 N/A INTRINSIC
Pfam:DUF1897 570 598 2e-7 PFAM
Pfam:DUF1897 599 631 9.2e-13 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000196529
AA Change: T374A
Predicted Effect probably benign
Transcript: ENSMUST00000198460
AA Change: T495A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000143573
Gene: ENSMUSG00000039103
AA Change: T495A

DomainStartEndE-ValueType
internal_repeat_1 14 35 1.01e-5 PROSPERO
low complexity region 36 53 N/A INTRINSIC
internal_repeat_1 86 106 1.01e-5 PROSPERO
low complexity region 108 131 N/A INTRINSIC
coiled coil region 226 345 N/A INTRINSIC
coiled coil region 378 406 N/A INTRINSIC
coiled coil region 429 480 N/A INTRINSIC
IG 506 590 2.1e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198734
Predicted Effect probably benign
Transcript: ENSMUST00000199423
AA Change: T572A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142936
Gene: ENSMUSG00000039103
AA Change: T572A

DomainStartEndE-ValueType
internal_repeat_1 14 35 4.74e-6 PROSPERO
low complexity region 36 53 N/A INTRINSIC
internal_repeat_1 86 106 4.74e-6 PROSPERO
low complexity region 108 131 N/A INTRINSIC
coiled coil region 240 422 N/A INTRINSIC
coiled coil region 455 483 N/A INTRINSIC
coiled coil region 506 557 N/A INTRINSIC
IG 583 667 2e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199470
AA Change: T438A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000143133
Gene: ENSMUSG00000039103
AA Change: T438A

DomainStartEndE-ValueType
internal_repeat_1 14 35 5.77e-6 PROSPERO
low complexity region 36 53 N/A INTRINSIC
internal_repeat_1 86 106 5.77e-6 PROSPERO
low complexity region 108 131 N/A INTRINSIC
low complexity region 176 210 N/A INTRINSIC
low complexity region 248 259 N/A INTRINSIC
coiled coil region 321 349 N/A INTRINSIC
coiled coil region 372 423 N/A INTRINSIC
IG 449 533 2e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199876
SMART Domains Protein: ENSMUSP00000143618
Gene: ENSMUSG00000028034

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 3e-8 PDB
KH 95 165 1.09e-17 SMART
KH 180 252 2.33e-17 SMART
KH 270 340 1.32e-16 SMART
low complexity region 345 367 N/A INTRINSIC
KH 371 444 1.19e-14 SMART
low complexity region 514 528 N/A INTRINSIC
low complexity region 531 557 N/A INTRINSIC
Pfam:DUF1897 572 600 1.5e-7 PFAM
Pfam:DUF1897 601 625 1.5e-9 PFAM
transmembrane domain 654 676 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199983
Predicted Effect probably benign
Transcript: ENSMUST00000200056
Predicted Effect probably benign
Transcript: ENSMUST00000200452
SMART Domains Protein: ENSMUSP00000143019
Gene: ENSMUSG00000028034

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 3e-8 PDB
KH 94 164 1.09e-17 SMART
KH 179 251 2.33e-17 SMART
KH 269 339 1.32e-16 SMART
low complexity region 344 366 N/A INTRINSIC
KH 370 443 1.19e-14 SMART
low complexity region 513 527 N/A INTRINSIC
low complexity region 530 556 N/A INTRINSIC
Pfam:DUF1897 570 598 2e-7 PFAM
Pfam:DUF1897 599 631 9.2e-13 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a filamentous actin-binding protein that may function in cell adhesion and migration. Mutations in this gene have been associated with dilated cardiomyopathy, also known as CMD1CC. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality with endomyocardial fibroelastosis, cardiac hypertrophy and dilated cardiomyopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T A 4: 42,971,706 F346L probably benign Het
Alox12b G T 11: 69,165,936 R386L probably damaging Het
Ano8 A T 8: 71,482,617 Y346N probably damaging Het
Cabp4 T C 19: 4,136,068 probably benign Het
Canx A T 11: 50,308,794 I148N probably damaging Het
Ccdc141 A G 2: 77,132,249 V117A probably benign Het
Cdk12 A T 11: 98,243,509 N1078Y unknown Het
Cdk7 T A 13: 100,730,460 K42* probably null Het
Col6a5 T C 9: 105,940,290 D274G unknown Het
Cux1 T C 5: 136,308,297 E696G probably damaging Het
Cxxc1 C T 18: 74,219,951 A444V probably benign Het
Dll1 T C 17: 15,368,689 K575E probably damaging Het
Dnah11 A G 12: 118,125,941 F1130S probably damaging Het
Dnah2 A G 11: 69,529,469 F140L probably damaging Het
Dysf T C 6: 84,186,468 V1625A probably damaging Het
Evi5 T C 5: 107,795,752 T592A probably benign Het
Fam46c A G 3: 100,472,708 L244P probably damaging Het
Fas T C 19: 34,316,643 S133P probably damaging Het
Gpr139 A G 7: 119,145,204 S53P probably benign Het
H2-Q4 T C 17: 35,380,435 F165L probably benign Het
Ighv9-2 A G 12: 114,109,218 V45A probably benign Het
Inpp1 T G 1: 52,794,547 D130A probably benign Het
Lin54 C T 5: 100,480,204 V47I probably benign Het
Nav3 TGAAGAAGAAGAAGA TGAAGAAGAAGA 10: 109,714,291 probably benign Het
Olfr1217 A T 2: 89,023,254 F250I probably damaging Het
Olfr967 T G 9: 39,750,488 I34S probably damaging Het
Pilrb1 T A 5: 137,855,053 M163L probably benign Het
Pkhd1 A T 1: 20,350,411 probably null Het
Ppard G A 17: 28,298,848 V297I probably benign Het
Rabgap1 T C 2: 37,475,357 V214A probably benign Het
Serpinc1 T C 1: 160,989,621 F95S probably damaging Het
Slc5a8 T C 10: 88,906,347 Y302H probably damaging Het
Slco4a1 G A 2: 180,464,459 A145T possibly damaging Het
Sptlc2 A T 12: 87,336,055 M425K possibly damaging Het
Trp53bp1 A G 2: 121,243,983 S429P probably benign Het
Unc13a T A 8: 71,652,564 T723S probably damaging Het
Ush2a A T 1: 188,821,717 I3468F possibly damaging Het
Utp20 A T 10: 88,750,670 D2547E probably benign Het
Wnk4 A G 11: 101,268,748 D593G possibly damaging Het
Zfyve26 A G 12: 79,268,982 L1240P probably damaging Het
Other mutations in Nexn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01316:Nexn APN 3 152247233 missense probably benign 0.00
IGL01681:Nexn APN 3 152243870 missense possibly damaging 0.86
IGL02098:Nexn APN 3 152243903 nonsense probably null
IGL02146:Nexn APN 3 152247248 missense probably benign 0.01
IGL02151:Nexn APN 3 152248244 missense probably damaging 0.99
R0369:Nexn UTSW 3 152248257 missense probably benign 0.40
R0540:Nexn UTSW 3 152248242 nonsense probably null
R1501:Nexn UTSW 3 152237686 missense possibly damaging 0.91
R1828:Nexn UTSW 3 152242768 missense probably damaging 1.00
R1903:Nexn UTSW 3 152248181 missense probably damaging 0.99
R1990:Nexn UTSW 3 152252939 missense probably damaging 1.00
R2857:Nexn UTSW 3 152248043 missense probably damaging 1.00
R2858:Nexn UTSW 3 152248043 missense probably damaging 1.00
R4482:Nexn UTSW 3 152242753 missense probably damaging 0.99
R4593:Nexn UTSW 3 152252916 missense probably damaging 1.00
R4750:Nexn UTSW 3 152237722 missense probably damaging 1.00
R5113:Nexn UTSW 3 152243888 missense probably damaging 1.00
R5289:Nexn UTSW 3 152248072 missense probably benign 0.13
R5502:Nexn UTSW 3 152238304 missense probably damaging 1.00
R5746:Nexn UTSW 3 152242876 unclassified probably benign
R6230:Nexn UTSW 3 152238275 missense probably damaging 1.00
R7251:Nexn UTSW 3 152247195 missense probably damaging 0.96
R7523:Nexn UTSW 3 152247178 missense probably benign 0.01
R7571:Nexn UTSW 3 152253647 missense possibly damaging 0.80
R7587:Nexn UTSW 3 152247178 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTCCATCTTCTGGGAAGGTTTC -3'
(R):5'- CTGTGTCAATGAAAACCAGGGC -3'

Sequencing Primer
(F):5'- TACAGGCAGTAAGTTTCACCTC -3'
(R):5'- TGAAAACCAGGGCATCATGC -3'
Posted On2016-07-06