Incidental Mutation 'R5252:Rabgap1'
ID399081
Institutional Source Beutler Lab
Gene Symbol Rabgap1
Ensembl Gene ENSMUSG00000035437
Gene NameRAB GTPase activating protein 1
SynonymsGapcena
MMRRC Submission 042823-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.716) question?
Stock #R5252 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location37443279-37566454 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37475357 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 214 (V214A)
Ref Sequence ENSEMBL: ENSMUSP00000121963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061179] [ENSMUST00000066055] [ENSMUST00000112920] [ENSMUST00000133434] [ENSMUST00000148470]
Predicted Effect probably benign
Transcript: ENSMUST00000061179
AA Change: V214A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000061624
Gene: ENSMUSG00000035437
AA Change: V214A

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
PTB 138 271 2.99e-30 SMART
Pfam:DUF3694 301 433 1.1e-38 PFAM
low complexity region 449 460 N/A INTRINSIC
low complexity region 473 481 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
TBC 558 770 9.27e-74 SMART
Blast:TBC 803 880 9e-33 BLAST
coiled coil region 986 1038 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066055
AA Change: V214A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000068835
Gene: ENSMUSG00000035437
AA Change: V214A

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
PTB 138 271 2.99e-30 SMART
Pfam:DUF3694 301 433 7.1e-39 PFAM
low complexity region 449 460 N/A INTRINSIC
low complexity region 473 481 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
TBC 558 770 9.27e-74 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112920
AA Change: V214A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108542
Gene: ENSMUSG00000035437
AA Change: V214A

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
PTB 138 271 2.99e-30 SMART
Pfam:DUF3694 301 432 1.6e-35 PFAM
low complexity region 449 460 N/A INTRINSIC
low complexity region 473 481 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
TBC 558 770 9.27e-74 SMART
Blast:TBC 803 880 9e-33 BLAST
coiled coil region 986 1038 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133434
AA Change: V214A

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000121963
Gene: ENSMUSG00000035437
AA Change: V214A

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
PTB 138 271 2.99e-30 SMART
Pfam:DUF3694 301 433 7.2e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148470
AA Change: V146A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119831
Gene: ENSMUSG00000035437
AA Change: V146A

DomainStartEndE-ValueType
SCOP:d1ddma_ 68 148 2e-17 SMART
Blast:PTB 70 148 1e-51 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153145
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T A 4: 42,971,706 F346L probably benign Het
Alox12b G T 11: 69,165,936 R386L probably damaging Het
Ano8 A T 8: 71,482,617 Y346N probably damaging Het
Cabp4 T C 19: 4,136,068 probably benign Het
Canx A T 11: 50,308,794 I148N probably damaging Het
Ccdc141 A G 2: 77,132,249 V117A probably benign Het
Cdk12 A T 11: 98,243,509 N1078Y unknown Het
Cdk7 T A 13: 100,730,460 K42* probably null Het
Col6a5 T C 9: 105,940,290 D274G unknown Het
Cux1 T C 5: 136,308,297 E696G probably damaging Het
Cxxc1 C T 18: 74,219,951 A444V probably benign Het
Dll1 T C 17: 15,368,689 K575E probably damaging Het
Dnah11 A G 12: 118,125,941 F1130S probably damaging Het
Dnah2 A G 11: 69,529,469 F140L probably damaging Het
Dysf T C 6: 84,186,468 V1625A probably damaging Het
Evi5 T C 5: 107,795,752 T592A probably benign Het
Fam46c A G 3: 100,472,708 L244P probably damaging Het
Fas T C 19: 34,316,643 S133P probably damaging Het
Gpr139 A G 7: 119,145,204 S53P probably benign Het
H2-Q4 T C 17: 35,380,435 F165L probably benign Het
Ighv9-2 A G 12: 114,109,218 V45A probably benign Het
Inpp1 T G 1: 52,794,547 D130A probably benign Het
Lin54 C T 5: 100,480,204 V47I probably benign Het
Nav3 TGAAGAAGAAGAAGA TGAAGAAGAAGA 10: 109,714,291 probably benign Het
Nexn T C 3: 152,237,953 T438A probably benign Het
Olfr1217 A T 2: 89,023,254 F250I probably damaging Het
Olfr967 T G 9: 39,750,488 I34S probably damaging Het
Pilrb1 T A 5: 137,855,053 M163L probably benign Het
Pkhd1 A T 1: 20,350,411 probably null Het
Ppard G A 17: 28,298,848 V297I probably benign Het
Serpinc1 T C 1: 160,989,621 F95S probably damaging Het
Slc5a8 T C 10: 88,906,347 Y302H probably damaging Het
Slco4a1 G A 2: 180,464,459 A145T possibly damaging Het
Sptlc2 A T 12: 87,336,055 M425K possibly damaging Het
Trp53bp1 A G 2: 121,243,983 S429P probably benign Het
Unc13a T A 8: 71,652,564 T723S probably damaging Het
Ush2a A T 1: 188,821,717 I3468F possibly damaging Het
Utp20 A T 10: 88,750,670 D2547E probably benign Het
Wnk4 A G 11: 101,268,748 D593G possibly damaging Het
Zfyve26 A G 12: 79,268,982 L1240P probably damaging Het
Other mutations in Rabgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Rabgap1 APN 2 37469546 missense probably damaging 1.00
IGL01456:Rabgap1 APN 2 37541175 missense probably damaging 0.99
IGL01599:Rabgap1 APN 2 37556269 missense probably damaging 1.00
IGL01834:Rabgap1 APN 2 37564761 intron probably benign
IGL01940:Rabgap1 APN 2 37487067 missense probably damaging 1.00
IGL02416:Rabgap1 APN 2 37561950 missense probably benign 0.00
IGL02683:Rabgap1 APN 2 37502939 missense probably damaging 1.00
IGL02755:Rabgap1 APN 2 37537314 missense probably damaging 0.98
IGL02999:Rabgap1 APN 2 37483826 missense possibly damaging 0.56
IGL03144:Rabgap1 APN 2 37540532 missense probably damaging 0.99
IGL02796:Rabgap1 UTSW 2 37472306 missense probably damaging 0.99
R0117:Rabgap1 UTSW 2 37561885 splice site probably null
R0455:Rabgap1 UTSW 2 37487120 missense probably damaging 1.00
R0569:Rabgap1 UTSW 2 37489717 intron probably benign
R0586:Rabgap1 UTSW 2 37543223 missense probably benign
R0962:Rabgap1 UTSW 2 37560469 intron probably benign
R1055:Rabgap1 UTSW 2 37492068 missense possibly damaging 0.91
R1086:Rabgap1 UTSW 2 37469446 missense probably damaging 0.99
R1251:Rabgap1 UTSW 2 37543234 splice site probably null
R1598:Rabgap1 UTSW 2 37561899 missense probably damaging 1.00
R1924:Rabgap1 UTSW 2 37495759 critical splice donor site probably null
R1957:Rabgap1 UTSW 2 37483762 missense possibly damaging 0.93
R2134:Rabgap1 UTSW 2 37563487 nonsense probably null
R2154:Rabgap1 UTSW 2 37475441 missense probably damaging 1.00
R4328:Rabgap1 UTSW 2 37532615 missense probably damaging 1.00
R4351:Rabgap1 UTSW 2 37483782 missense probably benign
R4658:Rabgap1 UTSW 2 37487549 nonsense probably null
R4821:Rabgap1 UTSW 2 37532519 missense probably damaging 1.00
R4897:Rabgap1 UTSW 2 37560571 missense probably benign 0.01
R5014:Rabgap1 UTSW 2 37487140 missense probably damaging 1.00
R5392:Rabgap1 UTSW 2 37469489 missense probably damaging 1.00
R5794:Rabgap1 UTSW 2 37502902 missense probably benign 0.03
R5941:Rabgap1 UTSW 2 37561896 missense possibly damaging 0.62
R6002:Rabgap1 UTSW 2 37473602 missense probably benign 0.05
R6209:Rabgap1 UTSW 2 37563598 nonsense probably null
R6317:Rabgap1 UTSW 2 37542647 missense possibly damaging 0.88
R7011:Rabgap1 UTSW 2 37540480 missense probably damaging 1.00
R7014:Rabgap1 UTSW 2 37560563 missense probably benign 0.08
R7514:Rabgap1 UTSW 2 37537342 missense probably damaging 1.00
R7543:Rabgap1 UTSW 2 37469432 missense probably damaging 0.99
R7599:Rabgap1 UTSW 2 37502896 frame shift probably null
R7709:Rabgap1 UTSW 2 37537327 missense possibly damaging 0.89
R7784:Rabgap1 UTSW 2 37487532 missense possibly damaging 0.91
R7816:Rabgap1 UTSW 2 37563464 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACATGGCTAGTATACTAGAAGTAGC -3'
(R):5'- CAGAGATAGTGGTGAAATCTCATTTGC -3'

Sequencing Primer
(F):5'- TCTCTCTGGACAAATACCCTAATG -3'
(R):5'- CTGCCTGGTCTATGAAATCAGTGAC -3'
Posted On2016-07-06