Incidental Mutation 'R5201:Olfr1419'
ID400842
Institutional Source Beutler Lab
Gene Symbol Olfr1419
Ensembl Gene ENSMUSG00000067545
Gene Nameolfactory receptor 1419
SynonymsMOR266-10, GA_x6K02T2RE5P-2222521-2221490
MMRRC Submission 042776-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5201 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location11868613-11875106 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 11870631 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 195 (I195K)
Ref Sequence ENSEMBL: ENSMUSP00000148848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087857] [ENSMUST00000213954] [ENSMUST00000217617]
Predicted Effect probably benign
Transcript: ENSMUST00000087857
AA Change: I195K

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000085163
Gene: ENSMUSG00000067545
AA Change: I195K

DomainStartEndE-ValueType
Pfam:7tm_4 31 309 3.8e-55 PFAM
Pfam:7tm_1 41 291 2.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213954
AA Change: I195K

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000217617
AA Change: I195K

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik C A 15: 82,062,544 T214N probably benign Het
Actn4 A T 7: 28,916,255 probably null Het
Arap2 T C 5: 62,683,489 E678G probably damaging Het
Atl2 T C 17: 79,865,151 N130S probably benign Het
Ccdc129 T C 6: 55,968,006 S571P probably benign Het
Cyp2b10 A G 7: 25,916,994 D342G probably damaging Het
Dnah6 A G 6: 73,195,732 Y248H possibly damaging Het
Drd5 A T 5: 38,320,023 M120L probably damaging Het
Duox1 A G 2: 122,327,922 R629G probably benign Het
Dyrk1b A G 7: 28,185,096 Y279C probably damaging Het
Efemp1 A T 11: 28,914,590 I215L probably benign Het
Enpp6 C A 8: 47,065,451 Q205K probably damaging Het
Fam170a A T 18: 50,282,126 T280S probably benign Het
Fam222a G A 5: 114,611,066 A108T possibly damaging Het
Fgd3 G T 13: 49,296,378 P132T probably benign Het
Fzr1 A T 10: 81,367,528 L399H probably damaging Het
Galnt15 G A 14: 32,049,865 R289Q probably damaging Het
Hira T C 16: 18,952,115 V834A probably damaging Het
Ilf3 T C 9: 21,389,383 L93P probably damaging Het
Itgae G A 11: 73,110,556 R71Q probably benign Het
Kif14 T A 1: 136,503,407 S1181T probably benign Het
Lrig3 C A 10: 126,013,151 P946Q possibly damaging Het
Macf1 A T 4: 123,475,945 C1674* probably null Het
Malt1 A G 18: 65,476,055 K710R probably benign Het
Man1a2 A T 3: 100,617,012 N373K probably benign Het
Mkl2 A C 16: 13,401,592 T701P probably benign Het
Mpped2 A G 2: 106,699,502 N32S possibly damaging Het
Myh10 A T 11: 68,783,195 T652S probably damaging Het
Nfia A G 4: 98,111,225 Y485C probably damaging Het
Olfml2b A T 1: 170,668,864 T355S probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh1 A T 18: 38,198,918 V344D probably damaging Het
Plekhn1 C A 4: 156,230,527 V558L probably benign Het
Prr14l A G 5: 32,830,247 S635P possibly damaging Het
Prss46 T A 9: 110,851,475 C229* probably null Het
Rad50 A G 11: 53,698,820 probably null Het
Slc27a3 A T 3: 90,389,219 L191Q probably benign Het
Spert A G 14: 75,584,009 V101A probably damaging Het
Surf4 A G 2: 26,933,766 probably benign Het
Taf3 A G 2: 9,952,184 S391P probably damaging Het
Tep1 A C 14: 50,868,110 L151R probably benign Het
Tmprss11d A C 5: 86,309,355 N148K possibly damaging Het
Tpd52l2 G A 2: 181,515,086 V172I probably benign Het
Vmn2r77 A G 7: 86,811,638 D724G probably damaging Het
Wdr75 T A 1: 45,823,359 D779E probably benign Het
Zfp943 A T 17: 21,992,813 K293N probably damaging Het
Other mutations in Olfr1419
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01845:Olfr1419 APN 19 11870524 missense probably benign 0.05
IGL01979:Olfr1419 APN 19 11871223 splice site probably benign
IGL02961:Olfr1419 APN 19 11870331 missense probably damaging 1.00
R0285:Olfr1419 UTSW 19 11871138 missense probably damaging 0.97
R0347:Olfr1419 UTSW 19 11870433 missense probably damaging 1.00
R1577:Olfr1419 UTSW 19 11870377 missense probably damaging 1.00
R2391:Olfr1419 UTSW 19 11870816 nonsense probably null
R3977:Olfr1419 UTSW 19 11870505 missense possibly damaging 0.82
R4660:Olfr1419 UTSW 19 11871048 missense possibly damaging 0.64
R5995:Olfr1419 UTSW 19 11870862 missense possibly damaging 0.89
R6393:Olfr1419 UTSW 19 11870727 missense probably damaging 1.00
R7466:Olfr1419 UTSW 19 11870316 missense possibly damaging 0.94
R7828:Olfr1419 UTSW 19 11870805 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGGGTGCAACATCCATACTG -3'
(R):5'- GGCCATCTGTCATCCATTGC -3'

Sequencing Primer
(F):5'- GTGCAACATCCATACTGCAGGAC -3'
(R):5'- ACAGCCTCATTATGAGTTGGCAG -3'
Posted On2016-07-06